Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   D7I46_RS08890 Genome accession   NZ_CP032627
Coordinates   1909403..1909699 (-) Length   98 a.a.
NCBI ID   WP_120772580.1    Uniprot ID   -
Organism   Lactococcus allomyrinae strain 1JSPR-7     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 1904403..1914699
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D7I46_RS08860 (D7I46_08860) - 1904525..1905334 (-) 810 WP_120772574.1 metal ABC transporter permease -
  D7I46_RS08865 (D7I46_08865) - 1905327..1906058 (-) 732 WP_120772575.1 metal ABC transporter ATP-binding protein -
  D7I46_RS08870 (D7I46_08870) - 1906449..1907291 (-) 843 WP_120772576.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  D7I46_RS08875 (D7I46_08875) - 1907926..1908384 (-) 459 WP_120772577.1 zinc-dependent MarR family transcriptional regulator -
  D7I46_RS08880 (D7I46_08880) comGG 1908675..1909022 (-) 348 WP_240424384.1 competence type IV pilus minor pilin ComGG -
  D7I46_RS08885 (D7I46_08885) comGF 1909000..1909419 (-) 420 WP_120772579.1 competence type IV pilus minor pilin ComGF Machinery gene
  D7I46_RS08890 (D7I46_08890) comGE 1909403..1909699 (-) 297 WP_120772580.1 competence type IV pilus minor pilin ComGE Machinery gene
  D7I46_RS08895 (D7I46_08895) comGD 1909671..1910078 (-) 408 WP_240424386.1 competence type IV pilus minor pilin ComGD Machinery gene
  D7I46_RS08900 (D7I46_08900) comGC 1910062..1910364 (-) 303 WP_120772581.1 competence type IV pilus major pilin ComGC Machinery gene
  D7I46_RS13665 comGB 1910369..1910647 (-) 279 WP_276116903.1 type II secretion system F family protein Machinery gene
  D7I46_RS08905 (D7I46_08905) comGB 1910656..1911342 (-) 687 WP_276116904.1 type II secretion system F family protein Machinery gene
  D7I46_RS08910 (D7I46_08910) comGA 1911296..1912279 (-) 984 WP_120772582.1 competence type IV pilus ATPase ComGA Machinery gene
  D7I46_RS08915 (D7I46_08915) - 1912377..1912733 (-) 357 WP_120772583.1 helix-turn-helix domain-containing protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 10839.81 Da        Isoelectric Point: 10.5440

>NTDB_id=317314 D7I46_RS08890 WP_120772580.1 1909403..1909699(-) (comGE) [Lactococcus allomyrinae strain 1JSPR-7]
MENLRKRSVKAYLLLESLITLALLSVLVSVVLTEVVNVRQQLTEINQQIEGLNVAKMATDSSLSKLSVNGAVIKITKGDK
RTVVTNHGKELLRLEIKN

Nucleotide


Download         Length: 297 bp        

>NTDB_id=317314 D7I46_RS08890 WP_120772580.1 1909403..1909699(-) (comGE) [Lactococcus allomyrinae strain 1JSPR-7]
GTGGAAAATTTAAGAAAACGGTCAGTTAAGGCATATTTACTACTTGAGAGTTTGATTACACTTGCTTTATTGTCAGTTTT
GGTAAGTGTTGTACTGACAGAAGTTGTAAATGTTCGTCAGCAACTGACAGAAATTAATCAACAGATTGAAGGTTTAAATG
TCGCAAAAATGGCAACTGACAGTAGTCTCTCAAAGTTGTCAGTAAATGGTGCAGTGATAAAAATAACGAAAGGTGATAAA
CGAACGGTGGTTACTAATCATGGGAAGGAATTATTGAGGCTTGAAATTAAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

55.102

100

0.551

Multiple sequence alignment