Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | CIW72_RS05870 | Genome accession | NZ_CP023159 |
| Coordinates | 1265938..1266057 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. malvacearum strain MS14003 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1260938..1271057
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CIW72_RS23240 | - | 1261232..1261516 (+) | 285 | WP_232515052.1 | SMR family transporter | - |
| CIW72_RS05850 (CIW72_05850) | - | 1261521..1262315 (+) | 795 | WP_005915828.1 | glycosyltransferase | - |
| CIW72_RS05855 (CIW72_05855) | - | 1262318..1263358 (+) | 1041 | WP_050554799.1 | glycosyltransferase | - |
| CIW72_RS05860 (CIW72_05860) | - | 1263351..1264007 (+) | 657 | WP_157733690.1 | methionine biosynthesis protein MetW | - |
| CIW72_RS05865 (CIW72_05865) | pilB | 1264105..1265841 (+) | 1737 | WP_005915821.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| CIW72_RS05870 (CIW72_05870) | pilB | 1265938..1266057 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| CIW72_RS05875 (CIW72_05875) | - | 1266213..1266356 (+) | 144 | WP_005915817.1 | hypothetical protein | - |
| CIW72_RS05880 (CIW72_05880) | pilR | 1266543..1267997 (-) | 1455 | WP_033481907.1 | sigma-54 dependent transcriptional regulator | Regulator |
| CIW72_RS05885 (CIW72_05885) | - | 1268262..1269875 (-) | 1614 | WP_005915814.1 | HAMP domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=245019 CIW72_RS05870 WP_005915819.1 1265938..1266057(+) (pilB) [Xanthomonas citri pv. malvacearum strain MS14003]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=245019 CIW72_RS05870 WP_005915819.1 1265938..1266057(+) (pilB) [Xanthomonas citri pv. malvacearum strain MS14003]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |