Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2087101..2087246 | Replicon | chromosome |
| Accession | NZ_AP023315 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4614 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2087141..2087244 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2087101..2087246 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5684_RS10160 | 2083527..2084225 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5684_RS10165 | 2084249..2084905 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5684_RS10170 | 2085013..2085243 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5684_RS10175 | 2085381..2085755 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5684_RS10180 | 2085756..2086631 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5684_RS10185 | 2086648..2087001 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2087101..2087246 | - | 146 | - | - | Antitoxin |
| - | 2087141..2087244 | + | 104 | - | - | Toxin |
| K5684_RS10190 | 2087375..2088298 | - | 924 | Protein_2004 | tyrosine-type recombinase/integrase | - |
| K5684_RS25225 | 2088562..2089023 | - | 462 | Protein_2005 | DNA breaking-rejoining protein | - |
| K5684_RS10200 | 2089012..2089203 | + | 192 | Protein_2006 | glycoside hydrolase family 19 protein | - |
| K5684_RS10205 | 2089257..2089790 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5684_RS10210 | 2090047..2090214 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5684_RS10215 | 2090279..2090467 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5684_RS10220 | 2090522..2090782 | + | 261 | Protein_2010 | DUF1441 family protein | - |
| K5684_RS10225 | 2090997..2091341 | + | 345 | Protein_2011 | macro domain-containing protein | - |
| K5684_RS10230 | 2091351..2091821 | + | 471 | Protein_2012 | tail fiber assembly protein | - |
| K5684_RS10235 | 2091918..2092118 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2081441..2119757 | 38316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37532 NZ_AP023315:2087141-2087244 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37532 NZ_AP023315:c2087246-2087101 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG