Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2079197..2079342 | Replicon | chromosome |
| Accession | NZ_AP023313 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4605 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2079237..2079340 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2079197..2079342 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5670_RS10105 | 2075623..2076321 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5670_RS10110 | 2076345..2077001 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5670_RS10115 | 2077109..2077339 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5670_RS10120 | 2077477..2077851 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5670_RS10125 | 2077852..2078727 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5670_RS10130 | 2078744..2079097 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2079197..2079342 | - | 146 | - | - | Antitoxin |
| - | 2079237..2079340 | + | 104 | - | - | Toxin |
| K5670_RS10135 | 2079471..2080394 | - | 924 | Protein_1991 | tyrosine-type recombinase/integrase | - |
| K5670_RS24490 | 2080658..2081119 | - | 462 | Protein_1992 | DNA breaking-rejoining protein | - |
| K5670_RS10145 | 2081108..2081299 | + | 192 | Protein_1993 | glycoside hydrolase family 19 protein | - |
| K5670_RS10150 | 2081353..2081886 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5670_RS10155 | 2082143..2082310 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5670_RS10160 | 2082375..2082563 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5670_RS10165 | 2082618..2082878 | + | 261 | Protein_1997 | DUF1441 family protein | - |
| K5670_RS10170 | 2083093..2083437 | + | 345 | Protein_1998 | macro domain-containing protein | - |
| K5670_RS10175 | 2083447..2083917 | + | 471 | Protein_1999 | tail fiber assembly protein | - |
| K5670_RS10180 | 2084014..2084214 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2073537..2111853 | 38316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37503 NZ_AP023313:2079237-2079340 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37503 NZ_AP023313:c2079342-2079197 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG