Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2059719..2059864 | Replicon | chromosome |
| Accession | NZ_AP023309 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4578 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2059759..2059862 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2059719..2059864 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5680_RS09975 | 2056145..2056843 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5680_RS09980 | 2056867..2057523 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5680_RS09985 | 2057631..2057861 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5680_RS09990 | 2057999..2058373 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5680_RS09995 | 2058374..2059249 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5680_RS10000 | 2059266..2059619 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2059719..2059864 | - | 146 | - | - | Antitoxin |
| - | 2059759..2059862 | + | 104 | - | - | Toxin |
| K5680_RS10005 | 2059993..2060916 | - | 924 | Protein_1966 | tyrosine-type recombinase/integrase | - |
| K5680_RS25030 | 2061180..2061641 | - | 462 | Protein_1967 | DNA breaking-rejoining protein | - |
| K5680_RS10015 | 2061630..2061821 | + | 192 | Protein_1968 | glycoside hydrolase family 19 protein | - |
| K5680_RS10020 | 2061875..2062408 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5680_RS10025 | 2062665..2062832 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5680_RS10030 | 2062897..2063085 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5680_RS10035 | 2063140..2063400 | + | 261 | Protein_1972 | DUF1441 family protein | - |
| K5680_RS10040 | 2063615..2063959 | + | 345 | Protein_1973 | macro domain-containing protein | - |
| K5680_RS10045 | 2063969..2064439 | + | 471 | Protein_1974 | tail fiber assembly protein | - |
| K5680_RS10050 | 2064536..2064736 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2054059..2092375 | 38316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37454 NZ_AP023309:2059759-2059862 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37454 NZ_AP023309:c2059864-2059719 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
