Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2087018..2087163 | Replicon | chromosome |
| Accession | NZ_AP023294 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4261 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2087058..2087161 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2087018..2087163 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5635_RS10150 | 2083444..2084142 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5635_RS10155 | 2084166..2084822 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5635_RS10160 | 2084930..2085160 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5635_RS10165 | 2085298..2085672 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5635_RS10170 | 2085673..2086548 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5635_RS10175 | 2086565..2086918 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2087018..2087163 | - | 146 | - | - | Antitoxin |
| - | 2087058..2087161 | + | 104 | - | - | Toxin |
| K5635_RS10180 | 2087292..2088215 | - | 924 | Protein_2001 | tyrosine-type recombinase/integrase | - |
| K5635_RS24395 | 2088479..2088940 | - | 462 | Protein_2002 | DNA breaking-rejoining protein | - |
| K5635_RS10190 | 2088929..2089120 | + | 192 | Protein_2003 | glycoside hydrolase family 19 protein | - |
| K5635_RS10195 | 2089174..2089707 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5635_RS10200 | 2089964..2090131 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5635_RS10205 | 2090196..2090384 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5635_RS10210 | 2090439..2090699 | + | 261 | Protein_2007 | DUF1441 family protein | - |
| K5635_RS10215 | 2090914..2091258 | + | 345 | Protein_2008 | macro domain-containing protein | - |
| K5635_RS10220 | 2091268..2091738 | + | 471 | Protein_2009 | tail fiber assembly protein | - |
| K5635_RS10225 | 2091835..2092035 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2081358..2119674 | 38316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37295 NZ_AP023294:2087058-2087161 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37295 NZ_AP023294:c2087163-2087018 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG