Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2087734..2087879 | Replicon | chromosome |
| Accession | NZ_AP023292 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4233 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2087774..2087877 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2087734..2087879 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5617_RS10160 | 2084160..2084858 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5617_RS10165 | 2084882..2085538 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5617_RS10170 | 2085646..2085876 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5617_RS10175 | 2086014..2086388 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5617_RS10180 | 2086389..2087264 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5617_RS10185 | 2087281..2087634 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2087734..2087879 | - | 146 | - | - | Antitoxin |
| - | 2087774..2087877 | + | 104 | - | - | Toxin |
| K5617_RS10190 | 2088008..2088931 | - | 924 | Protein_2002 | tyrosine-type recombinase/integrase | - |
| K5617_RS24015 | 2089195..2089656 | - | 462 | Protein_2003 | DNA breaking-rejoining protein | - |
| K5617_RS10200 | 2089645..2089836 | + | 192 | Protein_2004 | glycoside hydrolase family 19 protein | - |
| K5617_RS10205 | 2089890..2090423 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5617_RS10210 | 2090680..2090847 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5617_RS10215 | 2090912..2091100 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5617_RS10220 | 2091155..2091415 | + | 261 | Protein_2008 | DUF1441 family protein | - |
| K5617_RS10225 | 2091630..2091974 | + | 345 | Protein_2009 | macro domain-containing protein | - |
| K5617_RS10230 | 2091984..2092454 | + | 471 | Protein_2010 | tail fiber assembly protein | - |
| K5617_RS10235 | 2092551..2092751 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2082074..2120390 | 38316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37271 NZ_AP023292:2087774-2087877 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37271 NZ_AP023292:c2087879-2087734 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG