Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2114216..2114361 | Replicon | chromosome |
| Accession | NZ_AP023291 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain L-4126 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2114256..2114359 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2114216..2114361 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5613_RS10255 | 2110642..2111340 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5613_RS10260 | 2111364..2112020 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5613_RS10265 | 2112128..2112358 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5613_RS10270 | 2112496..2112870 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5613_RS10275 | 2112871..2113746 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5613_RS10280 | 2113763..2114116 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2114216..2114361 | - | 146 | - | - | Antitoxin |
| - | 2114256..2114359 | + | 104 | - | - | Toxin |
| K5613_RS10285 | 2114490..2115413 | - | 924 | Protein_2022 | tyrosine-type recombinase/integrase | - |
| K5613_RS24300 | 2115677..2116138 | - | 462 | Protein_2023 | DNA breaking-rejoining protein | - |
| K5613_RS10295 | 2116127..2116318 | + | 192 | Protein_2024 | glycoside hydrolase family 19 protein | - |
| K5613_RS10300 | 2116372..2116905 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5613_RS10305 | 2117162..2117329 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5613_RS10310 | 2117394..2117582 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5613_RS10315 | 2117637..2117897 | + | 261 | Protein_2028 | DUF1441 family protein | - |
| K5613_RS10320 | 2118112..2118456 | + | 345 | Protein_2029 | macro domain-containing protein | - |
| K5613_RS10325 | 2118466..2118936 | + | 471 | Protein_2030 | tail fiber assembly protein | - |
| K5613_RS10330 | 2119033..2119233 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2108556..2136556 | 28000 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37247 NZ_AP023291:2114256-2114359 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37247 NZ_AP023291:c2114361-2114216 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG