Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2103930..2104075 | Replicon | chromosome |
| Accession | NZ_AP023290 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-3844 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2103970..2104073 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2103930..2104075 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5615_RS10230 | 2100356..2101054 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5615_RS10235 | 2101078..2101734 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5615_RS10240 | 2101842..2102072 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5615_RS10245 | 2102210..2102584 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5615_RS10250 | 2102585..2103460 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5615_RS10255 | 2103477..2103830 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2103930..2104075 | - | 146 | - | - | Antitoxin |
| - | 2103970..2104073 | + | 104 | - | - | Toxin |
| K5615_RS10260 | 2104204..2105127 | - | 924 | Protein_2017 | tyrosine-type recombinase/integrase | - |
| K5615_RS24265 | 2105391..2105852 | - | 462 | Protein_2018 | DNA breaking-rejoining protein | - |
| K5615_RS10270 | 2105841..2106032 | + | 192 | Protein_2019 | glycoside hydrolase family 19 protein | - |
| K5615_RS10275 | 2106086..2106619 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5615_RS10280 | 2106876..2107043 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5615_RS10285 | 2107108..2107296 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5615_RS10290 | 2107351..2107611 | + | 261 | Protein_2023 | DUF1441 family protein | - |
| K5615_RS10295 | 2107826..2108170 | + | 345 | Protein_2024 | macro domain-containing protein | - |
| K5615_RS10300 | 2108180..2108650 | + | 471 | Protein_2025 | tail fiber assembly protein | - |
| K5615_RS10305 | 2108747..2108947 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2096593..2136587 | 39994 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37223 NZ_AP023290:2103970-2104073 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37223 NZ_AP023290:c2104075-2103930 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
