Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2209114..2209259 Replicon chromosome
Accession NZ_AP023289
Organism Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-3837

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2209154..2209257 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2209114..2209259 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
K5612_RS10820 2205540..2206238 - 699 WP_000944282.1 exodeoxyribonuclease X -
K5612_RS10825 2206262..2206918 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
K5612_RS10830 2207026..2207256 - 231 WP_000856224.1 DNA polymerase III subunit theta -
K5612_RS10835 2207394..2207768 + 375 WP_000168393.1 CopC domain-containing protein YobA -
K5612_RS10840 2207769..2208644 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
K5612_RS10845 2208661..2209014 + 354 WP_000722368.1 YebY family protein -
- 2209114..2209259 - 146 - - Antitoxin
- 2209154..2209257 + 104 - - Toxin
K5612_RS10850 2209388..2210311 - 924 Protein_2136 tyrosine-type recombinase/integrase -
K5612_RS24515 2210575..2211036 - 462 Protein_2137 DNA breaking-rejoining protein -
K5612_RS10860 2211025..2211216 + 192 Protein_2138 glycoside hydrolase family 19 protein -
K5612_RS10865 2211270..2211803 + 534 WP_001050882.1 DUF2514 domain-containing protein -
K5612_RS10870 2212060..2212227 - 168 WP_000789530.1 lytic enzyme -
K5612_RS10875 2212535..2212795 + 261 Protein_2141 DUF1441 family protein -
K5612_RS10880 2213010..2213354 + 345 Protein_2142 macro domain-containing protein -
K5612_RS10885 2213364..2213834 + 471 Protein_2143 tail fiber assembly protein -
K5612_RS10890 2213931..2214131 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2201777..2241771 39994


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T37199 NZ_AP023289:2209154-2209257 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT37199 NZ_AP023289:c2209259-2209114 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References