Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2140883..2141028 | Replicon | chromosome |
| Accession | NZ_AP023288 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-3835 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2140923..2141026 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2140883..2141028 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5610_RS10500 | 2137309..2138007 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5610_RS10505 | 2138031..2138687 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5610_RS10510 | 2138795..2139025 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5610_RS10515 | 2139163..2139537 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5610_RS10520 | 2139538..2140413 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5610_RS10525 | 2140430..2140783 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2140883..2141028 | - | 146 | - | - | Antitoxin |
| - | 2140923..2141026 | + | 104 | - | - | Toxin |
| K5610_RS10530 | 2141157..2142080 | - | 924 | Protein_2071 | tyrosine-type recombinase/integrase | - |
| K5610_RS24565 | 2142344..2142805 | - | 462 | Protein_2072 | DNA breaking-rejoining protein | - |
| K5610_RS10540 | 2142794..2142985 | + | 192 | Protein_2073 | glycoside hydrolase family 19 protein | - |
| K5610_RS10545 | 2143039..2143572 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5610_RS10550 | 2143829..2143996 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5610_RS10555 | 2144061..2144249 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5610_RS10560 | 2144304..2144564 | + | 261 | Protein_2077 | DUF1441 family protein | - |
| K5610_RS10565 | 2144779..2145123 | + | 345 | Protein_2078 | macro domain-containing protein | - |
| K5610_RS10570 | 2145133..2145603 | + | 471 | Protein_2079 | tail fiber assembly protein | - |
| K5610_RS10575 | 2145700..2145900 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2135223..2173540 | 38317 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37175 NZ_AP023288:2140923-2141026 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37175 NZ_AP023288:c2141028-2140883 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG