Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2009312..2009455 | Replicon | chromosome |
| Accession | NZ_CP128261 | ||
| Organism | Salmonella enterica subsp. enterica serovar Heidelberg isolate FT3-7B | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2009350..2009453 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2009312..2009455 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QR684_RS09570 | 2005736..2006434 | - | 699 | WP_000944284.1 | exodeoxyribonuclease X | - |
| QR684_RS09575 | 2006458..2007114 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| QR684_RS09580 | 2007222..2007452 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| QR684_RS09585 | 2007590..2007964 | + | 375 | WP_000168394.1 | CopC domain-containing protein YobA | - |
| QR684_RS09590 | 2007965..2008840 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| QR684_RS09595 | 2008857..2009210 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2009312..2009455 | - | 144 | - | - | Antitoxin |
| - | 2009350..2009453 | + | 104 | - | - | Toxin |
| QR684_RS09600 | 2009584..2010507 | - | 924 | Protein_1875 | tyrosine-type recombinase/integrase | - |
| QR684_RS09605 | 2010771..2011232 | - | 462 | Protein_1876 | DNA breaking-rejoining protein | - |
| QR684_RS09610 | 2011221..2011412 | + | 192 | Protein_1877 | glycoside hydrolase family 19 protein | - |
| QR684_RS09615 | 2011466..2011999 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| QR684_RS09620 | 2012256..2012423 | - | 168 | WP_000789529.1 | lytic enzyme | - |
| QR684_RS09625 | 2012731..2012991 | + | 261 | Protein_1880 | DUF1441 family protein | - |
| QR684_RS09630 | 2012993..2013208 | + | 216 | Protein_1881 | shikimate transporter | - |
| QR684_RS09635 | 2013218..2013505 | + | 288 | Protein_1882 | macro domain-containing protein | - |
| QR684_RS09640 | 2013518..2014029 | + | 512 | Protein_1883 | tail fiber assembly protein | - |
| QR684_RS09645 | 2014126..2014326 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2003650..2041973 | 38323 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T284496 NZ_CP128261:2009350-2009453 [Salmonella enterica subsp. enterica serovar Heidelberg]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT284496 NZ_CP128261:c2009455-2009312 [Salmonella enterica subsp. enterica serovar Heidelberg]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG