Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2009312..2009455 Replicon chromosome
Accession NZ_CP128261
Organism Salmonella enterica subsp. enterica serovar Heidelberg isolate FT3-7B

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2009350..2009453 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2009312..2009455 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
QR684_RS09570 2005736..2006434 - 699 WP_000944284.1 exodeoxyribonuclease X -
QR684_RS09575 2006458..2007114 - 657 WP_000100257.1 carbon-nitrogen hydrolase family protein -
QR684_RS09580 2007222..2007452 - 231 WP_000856224.1 DNA polymerase III subunit theta -
QR684_RS09585 2007590..2007964 + 375 WP_000168394.1 CopC domain-containing protein YobA -
QR684_RS09590 2007965..2008840 + 876 WP_000979694.1 copper homeostasis membrane protein CopD -
QR684_RS09595 2008857..2009210 + 354 WP_000722368.1 YebY family protein -
- 2009312..2009455 - 144 - - Antitoxin
- 2009350..2009453 + 104 - - Toxin
QR684_RS09600 2009584..2010507 - 924 Protein_1875 tyrosine-type recombinase/integrase -
QR684_RS09605 2010771..2011232 - 462 Protein_1876 DNA breaking-rejoining protein -
QR684_RS09610 2011221..2011412 + 192 Protein_1877 glycoside hydrolase family 19 protein -
QR684_RS09615 2011466..2011999 + 534 WP_001050883.1 DUF2514 domain-containing protein -
QR684_RS09620 2012256..2012423 - 168 WP_000789529.1 lytic enzyme -
QR684_RS09625 2012731..2012991 + 261 Protein_1880 DUF1441 family protein -
QR684_RS09630 2012993..2013208 + 216 Protein_1881 shikimate transporter -
QR684_RS09635 2013218..2013505 + 288 Protein_1882 macro domain-containing protein -
QR684_RS09640 2013518..2014029 + 512 Protein_1883 tail fiber assembly protein -
QR684_RS09645 2014126..2014326 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2003650..2041973 38323


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T284496 NZ_CP128261:2009350-2009453 [Salmonella enterica subsp. enterica serovar Heidelberg]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT284496 NZ_CP128261:c2009455-2009312 [Salmonella enterica subsp. enterica serovar Heidelberg]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References