Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2073466..2073611 | Replicon | chromosome |
| Accession | NZ_CP121262 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain 013 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2073506..2073609 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2073466..2073611 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P8621_RS10090 | 2069892..2070590 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| P8621_RS10095 | 2070614..2071270 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| P8621_RS10100 | 2071378..2071608 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P8621_RS10105 | 2071746..2072120 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P8621_RS10110 | 2072121..2072996 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| P8621_RS10115 | 2073013..2073366 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2073466..2073611 | - | 146 | - | - | Antitoxin |
| - | 2073506..2073609 | + | 104 | - | - | Toxin |
| P8621_RS10120 | 2073740..2074663 | - | 924 | Protein_1976 | tyrosine-type recombinase/integrase | - |
| P8621_RS10125 | 2074927..2075388 | - | 462 | Protein_1977 | DNA breaking-rejoining protein | - |
| P8621_RS10130 | 2075377..2075568 | + | 192 | Protein_1978 | glycoside hydrolase family 19 protein | - |
| P8621_RS10135 | 2075622..2076155 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| P8621_RS10140 | 2076412..2076579 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| P8621_RS10145 | 2076644..2076832 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| P8621_RS10150 | 2076887..2077147 | + | 261 | Protein_1982 | DUF1441 family protein | - |
| P8621_RS10155 | 2077362..2077706 | + | 345 | Protein_1983 | macro domain-containing protein | - |
| P8621_RS10160 | 2077716..2078186 | + | 471 | Protein_1984 | tail fiber assembly protein | - |
| P8621_RS10165 | 2078283..2078483 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2067806..2106115 | 38309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T276144 NZ_CP121262:2073506-2073609 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT276144 NZ_CP121262:c2073611-2073466 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG