Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2080800..2080945 Replicon chromosome
Accession NZ_CP117404
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain RM085

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2080840..2080943 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2080800..2080945 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQQ07_RS10060 2077226..2077924 - 699 WP_000944282.1 exodeoxyribonuclease X -
PQQ07_RS10065 2077948..2078604 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
PQQ07_RS10070 2078712..2078942 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQQ07_RS10075 2079080..2079454 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PQQ07_RS10080 2079455..2080330 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQQ07_RS10085 2080347..2080700 + 354 WP_000722368.1 YebY family protein -
- 2080800..2080945 - 146 - - Antitoxin
- 2080840..2080943 + 104 - - Toxin
PQQ07_RS10090 2081074..2081997 - 924 Protein_1972 tyrosine-type recombinase/integrase -
PQQ07_RS10095 2082261..2082722 - 462 Protein_1973 DNA breaking-rejoining protein -
PQQ07_RS10100 2082711..2082902 + 192 Protein_1974 glycoside hydrolase family 19 protein -
PQQ07_RS10105 2082956..2083489 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQQ07_RS10110 2083746..2083913 - 168 WP_000789530.1 lytic enzyme -
PQQ07_RS10115 2083978..2084166 - 189 WP_001521334.1 hypothetical protein -
PQQ07_RS10120 2084221..2084481 + 261 Protein_1978 DUF1441 family protein -
PQQ07_RS10125 2084696..2085040 + 345 Protein_1979 macro domain-containing protein -
PQQ07_RS10130 2085050..2085520 + 471 Protein_1980 tail fiber assembly protein -
PQQ07_RS10135 2085617..2085817 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2075140..2113447 38307


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T271196 NZ_CP117404:2080840-2080943 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT271196 NZ_CP117404:c2080945-2080800 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References