Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2134054..2134199 | Replicon | chromosome |
| Accession | NZ_CP117400 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain RM014 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2134094..2134197 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2134054..2134199 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP96_RS10435 | 2130480..2131178 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| PQP96_RS10440 | 2131202..2131858 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| PQP96_RS10445 | 2131966..2132196 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQP96_RS10450 | 2132334..2132708 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PQP96_RS10455 | 2132709..2133584 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| PQP96_RS10460 | 2133601..2133954 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2134054..2134199 | - | 146 | - | - | Antitoxin |
| - | 2134094..2134197 | + | 104 | - | - | Toxin |
| PQP96_RS10465 | 2134328..2135251 | - | 924 | Protein_2047 | tyrosine-type recombinase/integrase | - |
| PQP96_RS10470 | 2135515..2135976 | - | 462 | Protein_2048 | DNA breaking-rejoining protein | - |
| PQP96_RS10475 | 2135965..2136156 | + | 192 | Protein_2049 | glycoside hydrolase family 19 protein | - |
| PQP96_RS10480 | 2136210..2136743 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| PQP96_RS10485 | 2137000..2137167 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQP96_RS10490 | 2137232..2137420 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| PQP96_RS10495 | 2137475..2137735 | + | 261 | Protein_2053 | DUF1441 family protein | - |
| PQP96_RS10500 | 2137950..2138294 | + | 345 | Protein_2054 | macro domain-containing protein | - |
| PQP96_RS10505 | 2138304..2138774 | + | 471 | Protein_2055 | tail fiber assembly protein | - |
| PQP96_RS10510 | 2138871..2139071 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2128394..2153777 | 25383 | ||
| inside | Prophage | - | sopE2 | 2127075..2159048 | 31973 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T271163 NZ_CP117400:2134094-2134197 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT271163 NZ_CP117400:c2134199-2134054 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG