Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2134054..2134199 Replicon chromosome
Accession NZ_CP117398
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain RM015

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2134094..2134197 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2134054..2134199 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQQ09_RS10435 2130480..2131178 - 699 WP_000944282.1 exodeoxyribonuclease X -
PQQ09_RS10440 2131202..2131858 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
PQQ09_RS10445 2131966..2132196 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQQ09_RS10450 2132334..2132708 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PQQ09_RS10455 2132709..2133584 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQQ09_RS10460 2133601..2133954 + 354 WP_000722368.1 YebY family protein -
- 2134054..2134199 - 146 - - Antitoxin
- 2134094..2134197 + 104 - - Toxin
PQQ09_RS10465 2134328..2135251 - 924 Protein_2047 tyrosine-type recombinase/integrase -
PQQ09_RS10470 2135515..2135976 - 462 Protein_2048 DNA breaking-rejoining protein -
PQQ09_RS10475 2135965..2136156 + 192 Protein_2049 glycoside hydrolase family 19 protein -
PQQ09_RS10480 2136210..2136743 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQQ09_RS10485 2137000..2137167 - 168 WP_000789530.1 lytic enzyme -
PQQ09_RS10490 2137232..2137420 - 189 WP_001521334.1 hypothetical protein -
PQQ09_RS10495 2137475..2137735 + 261 Protein_2053 DUF1441 family protein -
PQQ09_RS10500 2137950..2138294 + 345 Protein_2054 macro domain-containing protein -
PQQ09_RS10505 2138304..2138774 + 471 Protein_2055 tail fiber assembly protein -
PQQ09_RS10510 2138871..2139071 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2128394..2153777 25383
inside Prophage - sopE2 2112186..2166703 54517


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T271143 NZ_CP117398:2134094-2134197 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT271143 NZ_CP117398:c2134199-2134054 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References