Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2128399..2128544 Replicon chromosome
Accession NZ_CP117370
Organism Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain RM054

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2128439..2128542 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2128399..2128544 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQP97_RS10445 2124825..2125523 - 699 WP_000944282.1 exodeoxyribonuclease X -
PQP97_RS10450 2125547..2126203 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
PQP97_RS10455 2126311..2126541 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQP97_RS10460 2126679..2127053 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PQP97_RS10465 2127054..2127929 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQP97_RS10470 2127946..2128299 + 354 WP_000722368.1 YebY family protein -
- 2128399..2128544 - 146 - - Antitoxin
- 2128439..2128542 + 104 - - Toxin
PQP97_RS10475 2128673..2129596 - 924 Protein_2049 tyrosine-type recombinase/integrase -
PQP97_RS10480 2129860..2130321 - 462 Protein_2050 DNA breaking-rejoining protein -
PQP97_RS10485 2130310..2130501 + 192 Protein_2051 glycoside hydrolase family 19 protein -
PQP97_RS10490 2130555..2131088 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQP97_RS10495 2131345..2131512 - 168 WP_000789530.1 lytic enzyme -
PQP97_RS10500 2131577..2131765 - 189 WP_001521334.1 hypothetical protein -
PQP97_RS10505 2131820..2132080 + 261 Protein_2055 DUF1441 family protein -
PQP97_RS10510 2132295..2132639 + 345 Protein_2056 macro domain-containing protein -
PQP97_RS10515 2132649..2133119 + 471 Protein_2057 tail fiber assembly protein -
PQP97_RS10520 2133216..2133416 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2122739..2161056 38317
inside Prophage - sopE2 2121062..2161056 39994


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T270873 NZ_CP117370:2128439-2128542 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT270873 NZ_CP117370:c2128544-2128399 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References