Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2059504..2059647 Replicon chromosome
Accession NZ_CP117348
Organism Salmonella enterica subsp. enterica serovar Heidelberg strain RM101

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2059542..2059645 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2059504..2059647 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQQ11_RS09915 2055928..2056626 - 699 WP_000944284.1 exodeoxyribonuclease X -
PQQ11_RS09920 2056650..2057306 - 657 WP_000100257.1 carbon-nitrogen hydrolase family protein -
PQQ11_RS09925 2057414..2057644 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQQ11_RS09930 2057782..2058156 + 375 WP_000168394.1 CopC domain-containing protein YobA -
PQQ11_RS09935 2058157..2059032 + 876 WP_000979694.1 copper homeostasis membrane protein CopD -
PQQ11_RS09940 2059049..2059402 + 354 WP_000722368.1 YebY family protein -
- 2059504..2059647 - 144 - - Antitoxin
- 2059542..2059645 + 104 - - Toxin
PQQ11_RS09945 2059776..2060699 - 924 Protein_1944 tyrosine-type recombinase/integrase -
PQQ11_RS09950 2060963..2061424 - 462 Protein_1945 DNA breaking-rejoining protein -
PQQ11_RS09955 2061413..2061604 + 192 Protein_1946 glycoside hydrolase family 19 protein -
PQQ11_RS09960 2061658..2062191 + 534 WP_001050883.1 DUF2514 domain-containing protein -
PQQ11_RS09965 2062448..2062615 - 168 WP_000789529.1 lytic enzyme -
PQQ11_RS09970 2062923..2063183 + 261 Protein_1949 DUF1441 family protein -
PQQ11_RS09975 2063185..2063400 + 216 Protein_1950 shikimate transporter -
PQQ11_RS09980 2063410..2063697 + 288 Protein_1951 macro domain-containing protein -
PQQ11_RS09985 2063710..2064221 + 512 Protein_1952 tail fiber assembly protein -
PQQ11_RS09990 2064318..2064518 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2053842..2092165 38323


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T270699 NZ_CP117348:2059542-2059645 [Salmonella enterica subsp. enterica serovar Heidelberg]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT270699 NZ_CP117348:c2059647-2059504 [Salmonella enterica subsp. enterica serovar Heidelberg]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References