Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2059504..2059647 | Replicon | chromosome |
| Accession | NZ_CP117348 | ||
| Organism | Salmonella enterica subsp. enterica serovar Heidelberg strain RM101 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2059542..2059645 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2059504..2059647 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQQ11_RS09915 | 2055928..2056626 | - | 699 | WP_000944284.1 | exodeoxyribonuclease X | - |
| PQQ11_RS09920 | 2056650..2057306 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| PQQ11_RS09925 | 2057414..2057644 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQQ11_RS09930 | 2057782..2058156 | + | 375 | WP_000168394.1 | CopC domain-containing protein YobA | - |
| PQQ11_RS09935 | 2058157..2059032 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| PQQ11_RS09940 | 2059049..2059402 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2059504..2059647 | - | 144 | - | - | Antitoxin |
| - | 2059542..2059645 | + | 104 | - | - | Toxin |
| PQQ11_RS09945 | 2059776..2060699 | - | 924 | Protein_1944 | tyrosine-type recombinase/integrase | - |
| PQQ11_RS09950 | 2060963..2061424 | - | 462 | Protein_1945 | DNA breaking-rejoining protein | - |
| PQQ11_RS09955 | 2061413..2061604 | + | 192 | Protein_1946 | glycoside hydrolase family 19 protein | - |
| PQQ11_RS09960 | 2061658..2062191 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| PQQ11_RS09965 | 2062448..2062615 | - | 168 | WP_000789529.1 | lytic enzyme | - |
| PQQ11_RS09970 | 2062923..2063183 | + | 261 | Protein_1949 | DUF1441 family protein | - |
| PQQ11_RS09975 | 2063185..2063400 | + | 216 | Protein_1950 | shikimate transporter | - |
| PQQ11_RS09980 | 2063410..2063697 | + | 288 | Protein_1951 | macro domain-containing protein | - |
| PQQ11_RS09985 | 2063710..2064221 | + | 512 | Protein_1952 | tail fiber assembly protein | - |
| PQQ11_RS09990 | 2064318..2064518 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2053842..2092165 | 38323 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270699 NZ_CP117348:2059542-2059645 [Salmonella enterica subsp. enterica serovar Heidelberg]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270699 NZ_CP117348:c2059647-2059504 [Salmonella enterica subsp. enterica serovar Heidelberg]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
