Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1988931..1989076 Replicon chromosome
Accession NZ_CP117327
Organism Salmonella enterica subsp. enterica serovar Saintpaul strain RM106

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1988971..1989074 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1988931..1989076 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQP95_RS09465 1985357..1986055 - 699 WP_000944282.1 exodeoxyribonuclease X -
PQP95_RS09470 1986079..1986735 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
PQP95_RS09475 1986843..1987073 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQP95_RS09480 1987211..1987585 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PQP95_RS09485 1987586..1988461 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQP95_RS09490 1988478..1988831 + 354 WP_000722368.1 YebY family protein -
- 1988931..1989076 - 146 - - Antitoxin
- 1988971..1989074 + 104 - - Toxin
PQP95_RS09495 1989205..1990128 - 924 Protein_1853 tyrosine-type recombinase/integrase -
PQP95_RS09500 1990392..1990853 - 462 Protein_1854 DNA breaking-rejoining protein -
PQP95_RS09505 1990842..1991033 + 192 Protein_1855 glycoside hydrolase family 19 protein -
PQP95_RS09510 1991087..1991620 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQP95_RS09515 1991877..1992044 - 168 WP_000789530.1 lytic enzyme -
PQP95_RS09520 1992109..1992297 - 189 WP_001521334.1 hypothetical protein -
PQP95_RS09525 1992352..1992612 + 261 Protein_1859 DUF1441 family protein -
PQP95_RS09530 1992614..1992829 + 216 Protein_1860 shikimate transporter -
PQP95_RS09535 1992827..1993171 + 345 Protein_1861 macro domain-containing protein -
PQP95_RS09540 1993181..1993651 + 471 Protein_1862 tail fiber assembly protein -
PQP95_RS09545 1993748..1993948 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1983271..2021595 38324


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T270527 NZ_CP117327:1988971-1989074 [Salmonella enterica subsp. enterica serovar Saintpaul]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT270527 NZ_CP117327:c1989076-1988931 [Salmonella enterica subsp. enterica serovar Saintpaul]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References