Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1988931..1989076 | Replicon | chromosome |
| Accession | NZ_CP117327 | ||
| Organism | Salmonella enterica subsp. enterica serovar Saintpaul strain RM106 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1988971..1989074 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1988931..1989076 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP95_RS09465 | 1985357..1986055 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| PQP95_RS09470 | 1986079..1986735 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| PQP95_RS09475 | 1986843..1987073 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQP95_RS09480 | 1987211..1987585 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PQP95_RS09485 | 1987586..1988461 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| PQP95_RS09490 | 1988478..1988831 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1988931..1989076 | - | 146 | - | - | Antitoxin |
| - | 1988971..1989074 | + | 104 | - | - | Toxin |
| PQP95_RS09495 | 1989205..1990128 | - | 924 | Protein_1853 | tyrosine-type recombinase/integrase | - |
| PQP95_RS09500 | 1990392..1990853 | - | 462 | Protein_1854 | DNA breaking-rejoining protein | - |
| PQP95_RS09505 | 1990842..1991033 | + | 192 | Protein_1855 | glycoside hydrolase family 19 protein | - |
| PQP95_RS09510 | 1991087..1991620 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| PQP95_RS09515 | 1991877..1992044 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQP95_RS09520 | 1992109..1992297 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| PQP95_RS09525 | 1992352..1992612 | + | 261 | Protein_1859 | DUF1441 family protein | - |
| PQP95_RS09530 | 1992614..1992829 | + | 216 | Protein_1860 | shikimate transporter | - |
| PQP95_RS09535 | 1992827..1993171 | + | 345 | Protein_1861 | macro domain-containing protein | - |
| PQP95_RS09540 | 1993181..1993651 | + | 471 | Protein_1862 | tail fiber assembly protein | - |
| PQP95_RS09545 | 1993748..1993948 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1983271..2021595 | 38324 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270527 NZ_CP117327:1988971-1989074 [Salmonella enterica subsp. enterica serovar Saintpaul]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270527 NZ_CP117327:c1989076-1988931 [Salmonella enterica subsp. enterica serovar Saintpaul]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG