Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2079105..2079250 Replicon chromosome
Accession NZ_CP117244
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2079145..2079248 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2079105..2079250 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQQ30_RS10080 2075531..2076229 - 699 WP_000944282.1 exodeoxyribonuclease X -
PQQ30_RS10085 2076253..2076909 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
PQQ30_RS10090 2077017..2077247 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQQ30_RS10095 2077385..2077759 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PQQ30_RS10100 2077760..2078635 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQQ30_RS10105 2078652..2079005 + 354 WP_000722368.1 YebY family protein -
- 2079105..2079250 - 146 - - Antitoxin
- 2079145..2079248 + 104 - - Toxin
PQQ30_RS10110 2079379..2080302 - 924 Protein_1976 tyrosine-type recombinase/integrase -
PQQ30_RS10115 2080566..2081027 - 462 Protein_1977 DNA breaking-rejoining protein -
PQQ30_RS10120 2081016..2081207 + 192 Protein_1978 glycoside hydrolase family 19 protein -
PQQ30_RS10125 2081261..2081794 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQQ30_RS10130 2082051..2082218 - 168 WP_000789530.1 lytic enzyme -
PQQ30_RS10135 2082283..2082471 - 189 WP_001521334.1 hypothetical protein -
PQQ30_RS10140 2082526..2082786 + 261 Protein_1982 DUF1441 family protein -
PQQ30_RS10145 2083001..2083345 + 345 Protein_1983 macro domain-containing protein -
PQQ30_RS10150 2083355..2083825 + 471 Protein_1984 tail fiber assembly protein -
PQQ30_RS10155 2083922..2084122 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2073445..2111754 38309


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T270173 NZ_CP117244:2079145-2079248 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT270173 NZ_CP117244:c2079250-2079105 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References