Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2128015..2128160 Replicon chromosome
Accession NZ_CP116042
Organism Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain BL708

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2128055..2128158 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2128015..2128160 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PGC28_RS10445 2124441..2125139 - 699 WP_000944282.1 exodeoxyribonuclease X -
PGC28_RS10450 2125163..2125819 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
PGC28_RS10455 2125927..2126157 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PGC28_RS10460 2126295..2126669 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PGC28_RS10465 2126670..2127545 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PGC28_RS10470 2127562..2127915 + 354 WP_000722368.1 YebY family protein -
- 2128015..2128160 - 146 - - Antitoxin
- 2128055..2128158 + 104 - - Toxin
PGC28_RS10475 2128289..2129212 - 924 Protein_2049 tyrosine-type recombinase/integrase -
PGC28_RS10480 2129476..2129937 - 462 Protein_2050 DNA breaking-rejoining protein -
PGC28_RS10485 2129926..2130117 + 192 Protein_2051 glycoside hydrolase family 19 protein -
PGC28_RS10490 2130171..2130704 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PGC28_RS10495 2130961..2131128 - 168 WP_000789530.1 lytic enzyme -
PGC28_RS10500 2131193..2131381 - 189 WP_001521334.1 hypothetical protein -
PGC28_RS10505 2131436..2131696 + 261 Protein_2055 DUF1441 family protein -
PGC28_RS10510 2131911..2132255 + 345 Protein_2056 macro domain-containing protein -
PGC28_RS10515 2132265..2132735 + 471 Protein_2057 tail fiber assembly protein -
PGC28_RS10520 2132832..2133032 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2122355..2160673 38318


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T267682 NZ_CP116042:2128055-2128158 [Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT267682 NZ_CP116042:c2128160-2128015 [Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References