Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2043703..2043848 | Replicon | chromosome |
| Accession | NZ_CP113538 | ||
| Organism | Salmonella enterica strain XSK | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2043743..2043846 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2043703..2043848 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OXV06_RS09725 | 2040129..2040827 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| OXV06_RS09730 | 2040851..2041507 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| OXV06_RS09735 | 2041615..2041845 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| OXV06_RS09740 | 2041983..2042357 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| OXV06_RS09745 | 2042358..2043233 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| OXV06_RS09750 | 2043250..2043603 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2043703..2043848 | - | 146 | - | - | Antitoxin |
| - | 2043743..2043846 | + | 104 | - | - | Toxin |
| OXV06_RS09755 | 2043977..2044900 | - | 924 | Protein_1906 | tyrosine-type recombinase/integrase | - |
| OXV06_RS09760 | 2045164..2045625 | - | 462 | Protein_1907 | DNA breaking-rejoining protein | - |
| OXV06_RS09765 | 2045614..2045805 | + | 192 | Protein_1908 | glycoside hydrolase family 19 protein | - |
| OXV06_RS09770 | 2045859..2046392 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| OXV06_RS09775 | 2046649..2046816 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| OXV06_RS09780 | 2046881..2047069 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| OXV06_RS09785 | 2047124..2047384 | + | 261 | Protein_1912 | DUF1441 family protein | - |
| OXV06_RS09790 | 2047386..2047601 | + | 216 | Protein_1913 | shikimate transporter | - |
| OXV06_RS09795 | 2047599..2047943 | + | 345 | Protein_1914 | macro domain-containing protein | - |
| OXV06_RS09800 | 2047953..2048423 | + | 471 | Protein_1915 | tail fiber assembly protein | - |
| OXV06_RS09805 | 2048520..2048720 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2038043..2063425 | 25382 | ||
| inside | Prophage | - | sopE2 | 2021835..2076351 | 54516 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T265956 NZ_CP113538:2043743-2043846 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT265956 NZ_CP113538:c2043848-2043703 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
