Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2043703..2043848 Replicon chromosome
Accession NZ_CP113538
Organism Salmonella enterica strain XSK

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2043743..2043846 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2043703..2043848 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
OXV06_RS09725 2040129..2040827 - 699 WP_000944282.1 exodeoxyribonuclease X -
OXV06_RS09730 2040851..2041507 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
OXV06_RS09735 2041615..2041845 - 231 WP_000856224.1 DNA polymerase III subunit theta -
OXV06_RS09740 2041983..2042357 + 375 WP_000168393.1 CopC domain-containing protein YobA -
OXV06_RS09745 2042358..2043233 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
OXV06_RS09750 2043250..2043603 + 354 WP_000722368.1 YebY family protein -
- 2043703..2043848 - 146 - - Antitoxin
- 2043743..2043846 + 104 - - Toxin
OXV06_RS09755 2043977..2044900 - 924 Protein_1906 tyrosine-type recombinase/integrase -
OXV06_RS09760 2045164..2045625 - 462 Protein_1907 DNA breaking-rejoining protein -
OXV06_RS09765 2045614..2045805 + 192 Protein_1908 glycoside hydrolase family 19 protein -
OXV06_RS09770 2045859..2046392 + 534 WP_001050882.1 DUF2514 domain-containing protein -
OXV06_RS09775 2046649..2046816 - 168 WP_000789530.1 lytic enzyme -
OXV06_RS09780 2046881..2047069 - 189 WP_001521334.1 hypothetical protein -
OXV06_RS09785 2047124..2047384 + 261 Protein_1912 DUF1441 family protein -
OXV06_RS09790 2047386..2047601 + 216 Protein_1913 shikimate transporter -
OXV06_RS09795 2047599..2047943 + 345 Protein_1914 macro domain-containing protein -
OXV06_RS09800 2047953..2048423 + 471 Protein_1915 tail fiber assembly protein -
OXV06_RS09805 2048520..2048720 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2038043..2063425 25382
inside Prophage - sopE2 2021835..2076351 54516


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T265956 NZ_CP113538:2043743-2043846 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT265956 NZ_CP113538:c2043848-2043703 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References