Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2143778..2143923 Replicon chromosome
Accession NZ_CP113535
Organism Salmonella enterica strain ZLQ

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2143818..2143921 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2143778..2143923 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
OXV11_RS10480 2140204..2140902 - 699 WP_000944282.1 exodeoxyribonuclease X -
OXV11_RS10485 2140926..2141582 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
OXV11_RS10490 2141690..2141920 - 231 WP_000856224.1 DNA polymerase III subunit theta -
OXV11_RS10495 2142058..2142432 + 375 WP_000168393.1 CopC domain-containing protein YobA -
OXV11_RS10500 2142433..2143308 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
OXV11_RS10505 2143325..2143678 + 354 WP_000722368.1 YebY family protein -
- 2143778..2143923 - 146 - - Antitoxin
- 2143818..2143921 + 104 - - Toxin
OXV11_RS10510 2144052..2144975 - 924 Protein_2057 tyrosine-type recombinase/integrase -
OXV11_RS10515 2145239..2145700 - 462 Protein_2058 DNA breaking-rejoining protein -
OXV11_RS10520 2145689..2145880 + 192 Protein_2059 glycoside hydrolase family 19 protein -
OXV11_RS10525 2145934..2146467 + 534 WP_001050882.1 DUF2514 domain-containing protein -
OXV11_RS10530 2146724..2146891 - 168 WP_000789530.1 lytic enzyme -
OXV11_RS10535 2146956..2147144 - 189 WP_001521334.1 hypothetical protein -
OXV11_RS10540 2147199..2147459 + 261 Protein_2063 DUF1441 family protein -
OXV11_RS10545 2147461..2147676 + 216 Protein_2064 shikimate transporter -
OXV11_RS10550 2147674..2148018 + 345 Protein_2065 macro domain-containing protein -
OXV11_RS10555 2148028..2148498 + 471 Protein_2066 tail fiber assembly protein -
OXV11_RS10560 2148595..2148795 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2138118..2163509 25391
inside Prophage - sopE2 2121910..2176435 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T265903 NZ_CP113535:2143818-2143921 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT265903 NZ_CP113535:c2143923-2143778 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References