Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2143778..2143923 | Replicon | chromosome |
| Accession | NZ_CP113535 | ||
| Organism | Salmonella enterica strain ZLQ | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2143818..2143921 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2143778..2143923 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OXV11_RS10480 | 2140204..2140902 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| OXV11_RS10485 | 2140926..2141582 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| OXV11_RS10490 | 2141690..2141920 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| OXV11_RS10495 | 2142058..2142432 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| OXV11_RS10500 | 2142433..2143308 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| OXV11_RS10505 | 2143325..2143678 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2143778..2143923 | - | 146 | - | - | Antitoxin |
| - | 2143818..2143921 | + | 104 | - | - | Toxin |
| OXV11_RS10510 | 2144052..2144975 | - | 924 | Protein_2057 | tyrosine-type recombinase/integrase | - |
| OXV11_RS10515 | 2145239..2145700 | - | 462 | Protein_2058 | DNA breaking-rejoining protein | - |
| OXV11_RS10520 | 2145689..2145880 | + | 192 | Protein_2059 | glycoside hydrolase family 19 protein | - |
| OXV11_RS10525 | 2145934..2146467 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| OXV11_RS10530 | 2146724..2146891 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| OXV11_RS10535 | 2146956..2147144 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| OXV11_RS10540 | 2147199..2147459 | + | 261 | Protein_2063 | DUF1441 family protein | - |
| OXV11_RS10545 | 2147461..2147676 | + | 216 | Protein_2064 | shikimate transporter | - |
| OXV11_RS10550 | 2147674..2148018 | + | 345 | Protein_2065 | macro domain-containing protein | - |
| OXV11_RS10555 | 2148028..2148498 | + | 471 | Protein_2066 | tail fiber assembly protein | - |
| OXV11_RS10560 | 2148595..2148795 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2138118..2163509 | 25391 | ||
| inside | Prophage | - | sopE2 | 2121910..2176435 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T265903 NZ_CP113535:2143818-2143921 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT265903 NZ_CP113535:c2143923-2143778 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG