Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2100664..2100809 | Replicon | chromosome |
| Accession | NZ_CP104484 | ||
| Organism | Salmonella enterica strain SalSpp_sample_07_No.3 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2100704..2100807 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2100664..2100809 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| N4231_RS10250 | 2097090..2097788 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| N4231_RS10255 | 2097812..2098468 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| N4231_RS10260 | 2098576..2098806 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| N4231_RS10265 | 2098944..2099318 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| N4231_RS10270 | 2099319..2100194 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| N4231_RS10275 | 2100211..2100564 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2100664..2100809 | - | 146 | - | - | Antitoxin |
| - | 2100704..2100807 | + | 104 | - | - | Toxin |
| N4231_RS10280 | 2100938..2101861 | - | 924 | Protein_2011 | tyrosine-type recombinase/integrase | - |
| N4231_RS10285 | 2102125..2102586 | - | 462 | Protein_2012 | DNA breaking-rejoining protein | - |
| N4231_RS10290 | 2102575..2102766 | + | 192 | Protein_2013 | glycoside hydrolase family 19 protein | - |
| N4231_RS10295 | 2102820..2103353 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| N4231_RS10300 | 2103610..2103777 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| N4231_RS10305 | 2103842..2104030 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| N4231_RS10310 | 2104085..2104345 | + | 261 | Protein_2017 | DUF1441 family protein | - |
| N4231_RS10315 | 2104560..2104904 | + | 345 | Protein_2018 | macro domain-containing protein | - |
| N4231_RS10320 | 2104914..2105384 | + | 471 | Protein_2019 | tail fiber assembly protein | - |
| N4231_RS10325 | 2105481..2105681 | - | 201 | WP_014344379.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2095004..2133321 | 38317 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T258079 NZ_CP104484:2100704-2100807 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT258079 NZ_CP104484:c2100809-2100664 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
