Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2170027..2170172 | Replicon | chromosome |
| Accession | NZ_CP102669 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2170067..2170170 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2170027..2170172 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NUW86_RS10710 | 2166453..2167151 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NUW86_RS10715 | 2167175..2167831 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NUW86_RS10720 | 2167939..2168169 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NUW86_RS10725 | 2168307..2168681 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NUW86_RS10730 | 2168682..2169557 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NUW86_RS10735 | 2169574..2169927 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2170027..2170172 | - | 146 | - | - | Antitoxin |
| - | 2170067..2170170 | + | 104 | - | - | Toxin |
| NUW86_RS10740 | 2170301..2171224 | - | 924 | Protein_2101 | tyrosine-type recombinase/integrase | - |
| NUW86_RS10745 | 2171488..2171949 | - | 462 | Protein_2102 | DNA breaking-rejoining protein | - |
| NUW86_RS10750 | 2171938..2172129 | + | 192 | Protein_2103 | glycoside hydrolase family 19 protein | - |
| NUW86_RS10755 | 2172183..2172716 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NUW86_RS10760 | 2172973..2173140 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NUW86_RS10765 | 2173205..2173393 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NUW86_RS10770 | 2173448..2173708 | + | 261 | Protein_2107 | DUF1441 family protein | - |
| NUW86_RS10775 | 2173923..2174267 | + | 345 | Protein_2108 | macro domain-containing protein | - |
| NUW86_RS10780 | 2174277..2174747 | + | 471 | Protein_2109 | tail fiber assembly protein | - |
| NUW86_RS10785 | 2174844..2175044 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2164367..2202676 | 38309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T253913 NZ_CP102669:2170067-2170170 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT253913 NZ_CP102669:c2170172-2170027 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
