Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 290387..290532 Replicon chromosome
Accession NZ_CP101940
Organism Salmonella enterica subsp. enterica strain QA-1986 974

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 290427..290530 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 290387..290532 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NP448_RS01520 286813..287511 - 699 WP_000944282.1 exodeoxyribonuclease X -
NP448_RS01525 287535..288191 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NP448_RS01530 288299..288529 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NP448_RS01535 288667..289041 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NP448_RS01540 289042..289917 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NP448_RS01545 289934..290287 + 354 WP_000722368.1 YebY family protein -
- 290387..290532 - 146 - - Antitoxin
- 290427..290530 + 104 - - Toxin
NP448_RS01550 290661..291584 - 924 Protein_301 tyrosine-type recombinase/integrase -
NP448_RS01555 291848..292309 - 462 Protein_302 DNA breaking-rejoining protein -
NP448_RS01560 292298..292489 + 192 Protein_303 glycoside hydrolase family 19 protein -
NP448_RS01565 292543..293076 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NP448_RS01570 293333..293500 - 168 WP_000789530.1 lytic enzyme -
NP448_RS01575 293565..293753 - 189 WP_001521334.1 hypothetical protein -
NP448_RS01580 293808..294068 + 261 Protein_307 DUF1441 family protein -
NP448_RS01585 294283..294627 + 345 Protein_308 macro domain-containing protein -
NP448_RS01590 294637..295107 + 471 Protein_309 tail fiber assembly protein -
NP448_RS01595 295204..295404 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 284727..323027 38300


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T253038 NZ_CP101940:290427-290530 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT253038 NZ_CP101940:c290532-290387 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References