Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2130451..2130596 | Replicon | chromosome |
| Accession | NZ_CP101388 | ||
| Organism | Salmonella enterica strain SC2017167 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2130491..2130594 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2130451..2130596 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NMU38_RS10445 | 2126877..2127575 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NMU38_RS10450 | 2127599..2128255 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NMU38_RS10455 | 2128363..2128593 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NMU38_RS10460 | 2128731..2129105 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NMU38_RS10465 | 2129106..2129981 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NMU38_RS10470 | 2129998..2130351 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2130451..2130596 | - | 146 | - | - | Antitoxin |
| - | 2130491..2130594 | + | 104 | - | - | Toxin |
| NMU38_RS10475 | 2130725..2131648 | - | 924 | Protein_2049 | tyrosine-type recombinase/integrase | - |
| NMU38_RS10480 | 2131912..2132373 | - | 462 | Protein_2050 | DNA breaking-rejoining protein | - |
| NMU38_RS10485 | 2132362..2132553 | + | 192 | Protein_2051 | glycoside hydrolase family 19 protein | - |
| NMU38_RS10490 | 2132607..2133140 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NMU38_RS10495 | 2133397..2133564 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NMU38_RS10500 | 2133629..2133817 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NMU38_RS10505 | 2133872..2134132 | + | 261 | Protein_2055 | DUF1441 family protein | - |
| NMU38_RS10510 | 2134347..2134691 | + | 345 | Protein_2056 | macro domain-containing protein | - |
| NMU38_RS10515 | 2134701..2135171 | + | 471 | Protein_2057 | tail fiber assembly protein | - |
| NMU38_RS10520 | 2135268..2135495 | - | 228 | WP_010989049.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2124791..2163108 | 38317 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T252099 NZ_CP101388:2130491-2130594 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT252099 NZ_CP101388:c2130596-2130451 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG