Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2130451..2130596 Replicon chromosome
Accession NZ_CP101388
Organism Salmonella enterica strain SC2017167

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2130491..2130594 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2130451..2130596 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU38_RS10445 2126877..2127575 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU38_RS10450 2127599..2128255 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU38_RS10455 2128363..2128593 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU38_RS10460 2128731..2129105 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU38_RS10465 2129106..2129981 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU38_RS10470 2129998..2130351 + 354 WP_000722368.1 YebY family protein -
- 2130451..2130596 - 146 - - Antitoxin
- 2130491..2130594 + 104 - - Toxin
NMU38_RS10475 2130725..2131648 - 924 Protein_2049 tyrosine-type recombinase/integrase -
NMU38_RS10480 2131912..2132373 - 462 Protein_2050 DNA breaking-rejoining protein -
NMU38_RS10485 2132362..2132553 + 192 Protein_2051 glycoside hydrolase family 19 protein -
NMU38_RS10490 2132607..2133140 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU38_RS10495 2133397..2133564 - 168 WP_000789530.1 lytic enzyme -
NMU38_RS10500 2133629..2133817 - 189 WP_001521334.1 hypothetical protein -
NMU38_RS10505 2133872..2134132 + 261 Protein_2055 DUF1441 family protein -
NMU38_RS10510 2134347..2134691 + 345 Protein_2056 macro domain-containing protein -
NMU38_RS10515 2134701..2135171 + 471 Protein_2057 tail fiber assembly protein -
NMU38_RS10520 2135268..2135495 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2124791..2163108 38317


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T252099 NZ_CP101388:2130491-2130594 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT252099 NZ_CP101388:c2130596-2130451 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References