Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2179523..2179668 | Replicon | chromosome |
| Accession | NZ_CP101386 | ||
| Organism | Salmonella enterica strain SC2017100 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2179563..2179666 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2179523..2179668 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NMU37_RS10710 | 2175949..2176647 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NMU37_RS10715 | 2176671..2177327 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NMU37_RS10720 | 2177435..2177665 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NMU37_RS10725 | 2177803..2178177 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NMU37_RS10730 | 2178178..2179053 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NMU37_RS10735 | 2179070..2179423 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2179523..2179668 | - | 146 | - | - | Antitoxin |
| - | 2179563..2179666 | + | 104 | - | - | Toxin |
| NMU37_RS10740 | 2179797..2180720 | - | 924 | Protein_2102 | tyrosine-type recombinase/integrase | - |
| NMU37_RS10745 | 2180984..2181445 | - | 462 | Protein_2103 | DNA breaking-rejoining protein | - |
| NMU37_RS10750 | 2181434..2181625 | + | 192 | Protein_2104 | glycoside hydrolase family 19 protein | - |
| NMU37_RS10755 | 2181679..2182212 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NMU37_RS10760 | 2182469..2182636 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NMU37_RS10765 | 2182701..2182889 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NMU37_RS10770 | 2182944..2183204 | + | 261 | Protein_2108 | DUF1441 family protein | - |
| NMU37_RS10775 | 2183419..2183763 | + | 345 | Protein_2109 | macro domain-containing protein | - |
| NMU37_RS10780 | 2183773..2184243 | + | 471 | Protein_2110 | tail fiber assembly protein | - |
| NMU37_RS10785 | 2184340..2184567 | - | 228 | WP_010989049.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2173863..2212180 | 38317 | ||
| inside | Prophage | - | sopE2 | 2157655..2212180 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T252079 NZ_CP101386:2179563-2179666 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT252079 NZ_CP101386:c2179668-2179523 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG