Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2179523..2179668 Replicon chromosome
Accession NZ_CP101386
Organism Salmonella enterica strain SC2017100

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2179563..2179666 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2179523..2179668 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU37_RS10710 2175949..2176647 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU37_RS10715 2176671..2177327 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU37_RS10720 2177435..2177665 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU37_RS10725 2177803..2178177 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU37_RS10730 2178178..2179053 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU37_RS10735 2179070..2179423 + 354 WP_000722368.1 YebY family protein -
- 2179523..2179668 - 146 - - Antitoxin
- 2179563..2179666 + 104 - - Toxin
NMU37_RS10740 2179797..2180720 - 924 Protein_2102 tyrosine-type recombinase/integrase -
NMU37_RS10745 2180984..2181445 - 462 Protein_2103 DNA breaking-rejoining protein -
NMU37_RS10750 2181434..2181625 + 192 Protein_2104 glycoside hydrolase family 19 protein -
NMU37_RS10755 2181679..2182212 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU37_RS10760 2182469..2182636 - 168 WP_000789530.1 lytic enzyme -
NMU37_RS10765 2182701..2182889 - 189 WP_001521334.1 hypothetical protein -
NMU37_RS10770 2182944..2183204 + 261 Protein_2108 DUF1441 family protein -
NMU37_RS10775 2183419..2183763 + 345 Protein_2109 macro domain-containing protein -
NMU37_RS10780 2183773..2184243 + 471 Protein_2110 tail fiber assembly protein -
NMU37_RS10785 2184340..2184567 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2173863..2212180 38317
inside Prophage - sopE2 2157655..2212180 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T252079 NZ_CP101386:2179563-2179666 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT252079 NZ_CP101386:c2179668-2179523 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References