Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2167217..2167362 Replicon chromosome
Accession NZ_CP101382
Organism Salmonella enterica strain SC2017030

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2167257..2167360 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2167217..2167362 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU36_RS10640 2163643..2164341 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU36_RS10645 2164365..2165021 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU36_RS10650 2165129..2165359 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU36_RS10655 2165497..2165871 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU36_RS10660 2165872..2166747 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU36_RS10665 2166764..2167117 + 354 WP_000722368.1 YebY family protein -
- 2167217..2167362 - 146 - - Antitoxin
- 2167257..2167360 + 104 - - Toxin
NMU36_RS10670 2167491..2168414 - 924 Protein_2088 tyrosine-type recombinase/integrase -
NMU36_RS10675 2168678..2169139 - 462 Protein_2089 DNA breaking-rejoining protein -
NMU36_RS10680 2169128..2169319 + 192 Protein_2090 glycoside hydrolase family 19 protein -
NMU36_RS10685 2169373..2169906 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU36_RS10690 2170163..2170330 - 168 WP_000789530.1 lytic enzyme -
NMU36_RS10695 2170395..2170583 - 189 WP_001521334.1 hypothetical protein -
NMU36_RS10700 2170638..2170898 + 261 Protein_2094 DUF1441 family protein -
NMU36_RS10705 2171113..2171457 + 345 Protein_2095 macro domain-containing protein -
NMU36_RS10710 2171467..2171937 + 471 Protein_2096 tail fiber assembly protein -
NMU36_RS10715 2172034..2172261 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2161557..2186948 25391
inside Prophage - sopE2 2145349..2199874 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T252059 NZ_CP101382:2167257-2167360 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT252059 NZ_CP101382:c2167362-2167217 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References