Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2123300..2123445 Replicon chromosome
Accession NZ_CP101379
Organism Salmonella enterica strain SC2016290

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2123340..2123443 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2123300..2123445 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU35_RS10425 2119726..2120424 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU35_RS10430 2120448..2121104 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU35_RS10435 2121212..2121442 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU35_RS10440 2121580..2121954 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU35_RS10445 2121955..2122830 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU35_RS10450 2122847..2123200 + 354 WP_000722368.1 YebY family protein -
- 2123300..2123445 - 146 - - Antitoxin
- 2123340..2123443 + 104 - - Toxin
NMU35_RS10455 2123574..2124497 - 924 Protein_2045 tyrosine-type recombinase/integrase -
NMU35_RS10460 2124761..2125222 - 462 Protein_2046 DNA breaking-rejoining protein -
NMU35_RS10465 2125211..2125402 + 192 Protein_2047 glycoside hydrolase family 19 protein -
NMU35_RS10470 2125456..2125989 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU35_RS10475 2126246..2126413 - 168 WP_000789530.1 lytic enzyme -
NMU35_RS10480 2126478..2126666 - 189 WP_001521334.1 hypothetical protein -
NMU35_RS10485 2126721..2126981 + 261 Protein_2051 DUF1441 family protein -
NMU35_RS10490 2127196..2127540 + 345 Protein_2052 macro domain-containing protein -
NMU35_RS10495 2127550..2128020 + 471 Protein_2053 tail fiber assembly protein -
NMU35_RS10500 2128117..2128344 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2117640..2143395 25755
inside Prophage - sopE2 2115963..2156321 40358


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T252036 NZ_CP101379:2123340-2123443 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT252036 NZ_CP101379:c2123445-2123300 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References