Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2128357..2128502 Replicon chromosome
Accession NZ_CP101376
Organism Salmonella enterica strain SC2016091

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2128397..2128500 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2128357..2128502 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU34_RS10430 2124783..2125481 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU34_RS10435 2125505..2126161 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU34_RS10440 2126269..2126499 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU34_RS10445 2126637..2127011 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU34_RS10450 2127012..2127887 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU34_RS10455 2127904..2128257 + 354 WP_000722368.1 YebY family protein -
- 2128357..2128502 - 146 - - Antitoxin
- 2128397..2128500 + 104 - - Toxin
NMU34_RS10460 2128631..2129554 - 924 Protein_2046 tyrosine-type recombinase/integrase -
NMU34_RS10465 2129818..2130279 - 462 Protein_2047 DNA breaking-rejoining protein -
NMU34_RS10470 2130268..2130459 + 192 Protein_2048 glycoside hydrolase family 19 protein -
NMU34_RS10475 2130513..2131046 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU34_RS10480 2131303..2131470 - 168 WP_000789530.1 lytic enzyme -
NMU34_RS10485 2131535..2131723 - 189 WP_001521334.1 hypothetical protein -
NMU34_RS10490 2131778..2132038 + 261 Protein_2052 DUF1441 family protein -
NMU34_RS10495 2132253..2132597 + 345 Protein_2053 macro domain-containing protein -
NMU34_RS10500 2132607..2133077 + 471 Protein_2054 tail fiber assembly protein -
NMU34_RS10505 2133174..2133401 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2122697..2161014 38317


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T252013 NZ_CP101376:2128397-2128500 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT252013 NZ_CP101376:c2128502-2128357 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References