Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2161248..2161393 Replicon chromosome
Accession NZ_CP101373
Organism Salmonella enterica strain SC2016042

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2161288..2161391 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2161248..2161393 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU32_RS10605 2157674..2158372 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU32_RS10610 2158396..2159052 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU32_RS10615 2159160..2159390 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU32_RS10620 2159528..2159902 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU32_RS10625 2159903..2160778 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU32_RS10630 2160795..2161148 + 354 WP_000722368.1 YebY family protein -
- 2161248..2161393 - 146 - - Antitoxin
- 2161288..2161391 + 104 - - Toxin
NMU32_RS10635 2161522..2162445 - 924 Protein_2081 tyrosine-type recombinase/integrase -
NMU32_RS10640 2162709..2163170 - 462 Protein_2082 DNA breaking-rejoining protein -
NMU32_RS10645 2163159..2163350 + 192 Protein_2083 glycoside hydrolase family 19 protein -
NMU32_RS10650 2163404..2163937 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU32_RS10655 2164194..2164361 - 168 WP_000789530.1 lytic enzyme -
NMU32_RS10660 2164426..2164614 - 189 WP_001521334.1 hypothetical protein -
NMU32_RS10665 2164669..2164929 + 261 Protein_2087 DUF1441 family protein -
NMU32_RS10670 2165144..2165488 + 345 Protein_2088 macro domain-containing protein -
NMU32_RS10675 2165498..2165968 + 471 Protein_2089 tail fiber assembly protein -
NMU32_RS10680 2166065..2166292 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2155588..2193904 38316


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T251972 NZ_CP101373:2161288-2161391 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT251972 NZ_CP101373:c2161393-2161248 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References