Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2161248..2161393 | Replicon | chromosome |
| Accession | NZ_CP101373 | ||
| Organism | Salmonella enterica strain SC2016042 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2161288..2161391 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2161248..2161393 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NMU32_RS10605 | 2157674..2158372 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NMU32_RS10610 | 2158396..2159052 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NMU32_RS10615 | 2159160..2159390 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NMU32_RS10620 | 2159528..2159902 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NMU32_RS10625 | 2159903..2160778 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NMU32_RS10630 | 2160795..2161148 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2161248..2161393 | - | 146 | - | - | Antitoxin |
| - | 2161288..2161391 | + | 104 | - | - | Toxin |
| NMU32_RS10635 | 2161522..2162445 | - | 924 | Protein_2081 | tyrosine-type recombinase/integrase | - |
| NMU32_RS10640 | 2162709..2163170 | - | 462 | Protein_2082 | DNA breaking-rejoining protein | - |
| NMU32_RS10645 | 2163159..2163350 | + | 192 | Protein_2083 | glycoside hydrolase family 19 protein | - |
| NMU32_RS10650 | 2163404..2163937 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NMU32_RS10655 | 2164194..2164361 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NMU32_RS10660 | 2164426..2164614 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NMU32_RS10665 | 2164669..2164929 | + | 261 | Protein_2087 | DUF1441 family protein | - |
| NMU32_RS10670 | 2165144..2165488 | + | 345 | Protein_2088 | macro domain-containing protein | - |
| NMU32_RS10675 | 2165498..2165968 | + | 471 | Protein_2089 | tail fiber assembly protein | - |
| NMU32_RS10680 | 2166065..2166292 | - | 228 | WP_010989049.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2155588..2193904 | 38316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251972 NZ_CP101373:2161288-2161391 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251972 NZ_CP101373:c2161393-2161248 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG