Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2452187..2452332 | Replicon | chromosome |
| Accession | NZ_CP101372 | ||
| Organism | Salmonella enterica strain SC2016025 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2452227..2452330 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2452187..2452332 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NMU31_RS12150 | 2448613..2449311 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NMU31_RS12155 | 2449335..2449991 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NMU31_RS12160 | 2450099..2450329 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NMU31_RS12165 | 2450467..2450841 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NMU31_RS12170 | 2450842..2451717 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NMU31_RS12175 | 2451734..2452087 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2452187..2452332 | - | 146 | - | - | Antitoxin |
| - | 2452227..2452330 | + | 104 | - | - | Toxin |
| NMU31_RS12180 | 2452461..2453384 | - | 924 | Protein_2390 | tyrosine-type recombinase/integrase | - |
| NMU31_RS12185 | 2453648..2454109 | - | 462 | Protein_2391 | DNA breaking-rejoining protein | - |
| NMU31_RS12190 | 2454098..2454289 | + | 192 | Protein_2392 | glycoside hydrolase family 19 protein | - |
| NMU31_RS12195 | 2454343..2454876 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NMU31_RS12200 | 2455133..2455300 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NMU31_RS12205 | 2455365..2455553 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NMU31_RS12210 | 2455608..2455868 | + | 261 | Protein_2396 | DUF1441 family protein | - |
| NMU31_RS12215 | 2456083..2456427 | + | 345 | Protein_2397 | macro domain-containing protein | - |
| NMU31_RS12220 | 2456437..2456907 | + | 471 | Protein_2398 | tail fiber assembly protein | - |
| NMU31_RS12225 | 2457004..2457231 | - | 228 | WP_010989049.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2446527..2484844 | 38317 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251953 NZ_CP101372:2452227-2452330 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251953 NZ_CP101372:c2452332-2452187 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG