Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2083721..2083866 | Replicon | chromosome |
| Accession | NZ_CP100715 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain R17.5474 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2083761..2083864 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2083721..2083866 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL730_RS10205 | 2080147..2080845 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NL730_RS10210 | 2080869..2081525 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NL730_RS10215 | 2081633..2081863 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL730_RS10220 | 2082001..2082375 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL730_RS10225 | 2082376..2083251 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NL730_RS10230 | 2083268..2083621 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2083721..2083866 | - | 146 | - | - | Antitoxin |
| - | 2083761..2083864 | + | 104 | - | - | Toxin |
| NL730_RS10235 | 2083995..2084918 | - | 924 | Protein_2002 | tyrosine-type recombinase/integrase | - |
| NL730_RS10240 | 2085182..2085643 | - | 462 | Protein_2003 | DNA breaking-rejoining protein | - |
| NL730_RS10245 | 2085632..2085823 | + | 192 | Protein_2004 | glycoside hydrolase family 19 protein | - |
| NL730_RS10250 | 2085877..2086410 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NL730_RS10255 | 2086667..2086834 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL730_RS10260 | 2086899..2087087 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NL730_RS10265 | 2087142..2087402 | + | 261 | Protein_2008 | DUF1441 family protein | - |
| NL730_RS10270 | 2087404..2087619 | + | 216 | Protein_2009 | shikimate transporter | - |
| NL730_RS10275 | 2087617..2087961 | + | 345 | Protein_2010 | macro domain-containing protein | - |
| NL730_RS10280 | 2087971..2088441 | + | 471 | Protein_2011 | tail fiber assembly protein | - |
| NL730_RS10285 | 2088538..2088738 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2078061..2103452 | 25391 | ||
| inside | Prophage | - | sopE2 | 2076742..2108723 | 31981 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251179 NZ_CP100715:2083761-2083864 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251179 NZ_CP100715:c2083866-2083721 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
