Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2092278..2092423 | Replicon | chromosome |
| Accession | NZ_CP100707 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain R18.0409 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2092318..2092421 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2092278..2092423 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL735_RS10270 | 2088704..2089402 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NL735_RS10275 | 2089426..2090082 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NL735_RS10280 | 2090190..2090420 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL735_RS10285 | 2090558..2090932 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL735_RS10290 | 2090933..2091808 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NL735_RS10295 | 2091825..2092178 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2092278..2092423 | - | 146 | - | - | Antitoxin |
| - | 2092318..2092421 | + | 104 | - | - | Toxin |
| NL735_RS10300 | 2092552..2093475 | - | 924 | Protein_2015 | tyrosine-type recombinase/integrase | - |
| NL735_RS10305 | 2093739..2094200 | - | 462 | Protein_2016 | DNA breaking-rejoining protein | - |
| NL735_RS10310 | 2094189..2094380 | + | 192 | Protein_2017 | glycoside hydrolase family 19 protein | - |
| NL735_RS10315 | 2094434..2094967 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NL735_RS10320 | 2095224..2095391 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL735_RS10325 | 2095456..2095644 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NL735_RS10330 | 2095699..2095959 | + | 261 | Protein_2021 | DUF1441 family protein | - |
| NL735_RS10335 | 2095961..2096176 | + | 216 | Protein_2022 | shikimate transporter | - |
| NL735_RS10340 | 2096174..2096518 | + | 345 | Protein_2023 | macro domain-containing protein | - |
| NL735_RS10345 | 2096528..2096998 | + | 471 | Protein_2024 | tail fiber assembly protein | - |
| NL735_RS10350 | 2097095..2097295 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2086618..2124935 | 38317 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251134 NZ_CP100707:2092318-2092421 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251134 NZ_CP100707:c2092423-2092278 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG