Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2200949..2201094 | Replicon | chromosome |
| Accession | NZ_CP100691 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain R17.3867 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2200989..2201092 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2200949..2201094 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL690_RS10700 | 2197375..2198073 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NL690_RS10705 | 2198097..2198753 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NL690_RS10710 | 2198861..2199091 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL690_RS10715 | 2199229..2199603 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL690_RS10720 | 2199604..2200479 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NL690_RS10725 | 2200496..2200849 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2200949..2201094 | - | 146 | - | - | Antitoxin |
| - | 2200989..2201092 | + | 104 | - | - | Toxin |
| NL690_RS10730 | 2201223..2202146 | - | 924 | Protein_2100 | tyrosine-type recombinase/integrase | - |
| NL690_RS10735 | 2202410..2202871 | - | 462 | Protein_2101 | DNA breaking-rejoining protein | - |
| NL690_RS10740 | 2202860..2203051 | + | 192 | Protein_2102 | glycoside hydrolase family 19 protein | - |
| NL690_RS10745 | 2203105..2203638 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NL690_RS10750 | 2203895..2204062 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL690_RS10755 | 2204127..2204315 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NL690_RS10760 | 2204370..2204630 | + | 261 | Protein_2106 | DUF1441 family protein | - |
| NL690_RS10765 | 2204845..2205189 | + | 345 | Protein_2107 | macro domain-containing protein | - |
| NL690_RS10770 | 2205199..2205669 | + | 471 | Protein_2108 | tail fiber assembly protein | - |
| NL690_RS10775 | 2205766..2205966 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2195289..2234936 | 39647 | ||
| - | inside | Prophage | - | sopE2 | 2167632..2234936 | 67304 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251039 NZ_CP100691:2200989-2201092 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251039 NZ_CP100691:c2201094-2200949 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
