Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2103373..2103518 Replicon chromosome
Accession NZ_CP099705
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain 013+

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2103413..2103516 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2103373..2103518 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NG892_RS10285 2099799..2100497 - 699 WP_000944282.1 exodeoxyribonuclease X -
NG892_RS10290 2100521..2101177 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NG892_RS10295 2101285..2101515 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NG892_RS10300 2101653..2102027 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NG892_RS10305 2102028..2102903 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NG892_RS10310 2102920..2103273 + 354 WP_000722368.1 YebY family protein -
- 2103373..2103518 - 146 - - Antitoxin
- 2103413..2103516 + 104 - - Toxin
NG892_RS10315 2103647..2104570 - 924 Protein_2015 tyrosine-type recombinase/integrase -
NG892_RS10320 2104834..2105295 - 462 Protein_2016 DNA breaking-rejoining protein -
NG892_RS10325 2105284..2105475 + 192 Protein_2017 glycoside hydrolase family 19 protein -
NG892_RS10330 2105529..2106062 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NG892_RS10335 2106319..2106486 - 168 WP_000789530.1 lytic enzyme -
NG892_RS10340 2106551..2106739 - 189 WP_001521334.1 hypothetical protein -
NG892_RS10345 2106794..2107054 + 261 Protein_2021 DUF1441 family protein -
NG892_RS10350 2107269..2107613 + 345 Protein_2022 macro domain-containing protein -
NG892_RS10355 2107623..2108093 + 471 Protein_2023 tail fiber assembly protein -
NG892_RS10360 2108190..2108390 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2097713..2136022 38309
inside Prophage - sopE2 2081505..2136022 54517


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T249294 NZ_CP099705:2103413-2103516 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT249294 NZ_CP099705:c2103518-2103373 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References