Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2103373..2103518 | Replicon | chromosome |
| Accession | NZ_CP099705 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain 013+ | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2103413..2103516 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2103373..2103518 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NG892_RS10285 | 2099799..2100497 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NG892_RS10290 | 2100521..2101177 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NG892_RS10295 | 2101285..2101515 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NG892_RS10300 | 2101653..2102027 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NG892_RS10305 | 2102028..2102903 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NG892_RS10310 | 2102920..2103273 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2103373..2103518 | - | 146 | - | - | Antitoxin |
| - | 2103413..2103516 | + | 104 | - | - | Toxin |
| NG892_RS10315 | 2103647..2104570 | - | 924 | Protein_2015 | tyrosine-type recombinase/integrase | - |
| NG892_RS10320 | 2104834..2105295 | - | 462 | Protein_2016 | DNA breaking-rejoining protein | - |
| NG892_RS10325 | 2105284..2105475 | + | 192 | Protein_2017 | glycoside hydrolase family 19 protein | - |
| NG892_RS10330 | 2105529..2106062 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NG892_RS10335 | 2106319..2106486 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NG892_RS10340 | 2106551..2106739 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NG892_RS10345 | 2106794..2107054 | + | 261 | Protein_2021 | DUF1441 family protein | - |
| NG892_RS10350 | 2107269..2107613 | + | 345 | Protein_2022 | macro domain-containing protein | - |
| NG892_RS10355 | 2107623..2108093 | + | 471 | Protein_2023 | tail fiber assembly protein | - |
| NG892_RS10360 | 2108190..2108390 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2097713..2136022 | 38309 | ||
| inside | Prophage | - | sopE2 | 2081505..2136022 | 54517 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T249294 NZ_CP099705:2103413-2103516 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT249294 NZ_CP099705:c2103518-2103373 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
