Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2632574..2632719 Replicon chromosome
Accession NZ_CP091547
Organism Salmonella enterica strain 1559

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2632576..2632679 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2632574..2632719 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L4413_RS12965 2627702..2627902 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
L4413_RS12970 2627999..2628469 - 471 Protein_2531 tail fiber assembly protein -
L4413_RS12975 2628479..2628823 - 345 Protein_2532 macro domain-containing protein -
L4413_RS12980 2629038..2629298 - 261 Protein_2533 DUF1441 family protein -
L4413_RS12985 2629353..2629541 + 189 WP_001521334.1 hypothetical protein -
L4413_RS12990 2629606..2629773 + 168 WP_000789530.1 lytic enzyme -
L4413_RS12995 2630030..2630563 - 534 WP_001050882.1 DUF2514 domain-containing protein -
L4413_RS13000 2630617..2630808 - 192 Protein_2537 glycoside hydrolase family 19 protein -
L4413_RS13005 2630797..2631258 + 462 Protein_2538 DNA breaking-rejoining protein -
L4413_RS13010 2631522..2632445 + 924 Protein_2539 tyrosine-type recombinase/integrase -
- 2632574..2632719 + 146 - - Antitoxin
- 2632576..2632679 - 104 - - Toxin
L4413_RS13015 2632819..2633172 - 354 WP_000722368.1 YebY family protein -
L4413_RS13020 2633189..2634064 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
L4413_RS13025 2634065..2634439 - 375 WP_000168393.1 CopC domain-containing protein YobA -
L4413_RS13030 2634577..2634807 + 231 WP_000856224.1 DNA polymerase III subunit theta -
L4413_RS13035 2634915..2635571 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
L4413_RS13040 2635595..2636293 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2610379..2638379 28000


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T233656 NZ_CP091547:c2632679-2632576 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT233656 NZ_CP091547:2632574-2632719 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References