Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2632574..2632719 | Replicon | chromosome |
| Accession | NZ_CP091547 | ||
| Organism | Salmonella enterica strain 1559 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2632576..2632679 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2632574..2632719 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L4413_RS12965 | 2627702..2627902 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| L4413_RS12970 | 2627999..2628469 | - | 471 | Protein_2531 | tail fiber assembly protein | - |
| L4413_RS12975 | 2628479..2628823 | - | 345 | Protein_2532 | macro domain-containing protein | - |
| L4413_RS12980 | 2629038..2629298 | - | 261 | Protein_2533 | DUF1441 family protein | - |
| L4413_RS12985 | 2629353..2629541 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| L4413_RS12990 | 2629606..2629773 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| L4413_RS12995 | 2630030..2630563 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| L4413_RS13000 | 2630617..2630808 | - | 192 | Protein_2537 | glycoside hydrolase family 19 protein | - |
| L4413_RS13005 | 2630797..2631258 | + | 462 | Protein_2538 | DNA breaking-rejoining protein | - |
| L4413_RS13010 | 2631522..2632445 | + | 924 | Protein_2539 | tyrosine-type recombinase/integrase | - |
| - | 2632574..2632719 | + | 146 | - | - | Antitoxin |
| - | 2632576..2632679 | - | 104 | - | - | Toxin |
| L4413_RS13015 | 2632819..2633172 | - | 354 | WP_000722368.1 | YebY family protein | - |
| L4413_RS13020 | 2633189..2634064 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L4413_RS13025 | 2634065..2634439 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L4413_RS13030 | 2634577..2634807 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L4413_RS13035 | 2634915..2635571 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L4413_RS13040 | 2635595..2636293 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2610379..2638379 | 28000 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233656 NZ_CP091547:c2632679-2632576 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233656 NZ_CP091547:2632574-2632719 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG