Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2189642..2189787 | Replicon | chromosome |
| Accession | NZ_CP090545 | ||
| Organism | Salmonella enterica strain 2017028-SE | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2189682..2189785 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2189642..2189787 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L0F57_RS10755 | 2186068..2186766 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| L0F57_RS10760 | 2186790..2187446 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L0F57_RS10765 | 2187554..2187784 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L0F57_RS10770 | 2187922..2188296 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L0F57_RS10775 | 2188297..2189172 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L0F57_RS10780 | 2189189..2189542 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2189642..2189787 | - | 146 | - | - | Antitoxin |
| - | 2189682..2189785 | + | 104 | - | - | Toxin |
| L0F57_RS10785 | 2189916..2190839 | - | 924 | Protein_2114 | tyrosine-type recombinase/integrase | - |
| L0F57_RS10790 | 2191103..2191564 | - | 462 | Protein_2115 | DNA breaking-rejoining protein | - |
| L0F57_RS10795 | 2191553..2191744 | + | 192 | Protein_2116 | glycoside hydrolase family 19 protein | - |
| L0F57_RS10800 | 2191798..2192331 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| L0F57_RS10805 | 2192588..2192755 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| L0F57_RS10810 | 2192820..2193008 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| L0F57_RS10815 | 2193063..2193323 | + | 261 | Protein_2120 | DUF1441 family protein | - |
| L0F57_RS10820 | 2193538..2193882 | + | 345 | Protein_2121 | macro domain-containing protein | - |
| L0F57_RS10825 | 2193892..2194362 | + | 471 | Protein_2122 | tail fiber assembly protein | - |
| L0F57_RS10830 | 2194459..2194659 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2183982..2222299 | 38317 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T231149 NZ_CP090545:2189682-2189785 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT231149 NZ_CP090545:c2189787-2189642 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG