Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2189642..2189787 Replicon chromosome
Accession NZ_CP090545
Organism Salmonella enterica strain 2017028-SE

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2189682..2189785 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2189642..2189787 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L0F57_RS10755 2186068..2186766 - 699 WP_000944282.1 exodeoxyribonuclease X -
L0F57_RS10760 2186790..2187446 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
L0F57_RS10765 2187554..2187784 - 231 WP_000856224.1 DNA polymerase III subunit theta -
L0F57_RS10770 2187922..2188296 + 375 WP_000168393.1 CopC domain-containing protein YobA -
L0F57_RS10775 2188297..2189172 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
L0F57_RS10780 2189189..2189542 + 354 WP_000722368.1 YebY family protein -
- 2189642..2189787 - 146 - - Antitoxin
- 2189682..2189785 + 104 - - Toxin
L0F57_RS10785 2189916..2190839 - 924 Protein_2114 tyrosine-type recombinase/integrase -
L0F57_RS10790 2191103..2191564 - 462 Protein_2115 DNA breaking-rejoining protein -
L0F57_RS10795 2191553..2191744 + 192 Protein_2116 glycoside hydrolase family 19 protein -
L0F57_RS10800 2191798..2192331 + 534 WP_001050882.1 DUF2514 domain-containing protein -
L0F57_RS10805 2192588..2192755 - 168 WP_000789530.1 lytic enzyme -
L0F57_RS10810 2192820..2193008 - 189 WP_001521334.1 hypothetical protein -
L0F57_RS10815 2193063..2193323 + 261 Protein_2120 DUF1441 family protein -
L0F57_RS10820 2193538..2193882 + 345 Protein_2121 macro domain-containing protein -
L0F57_RS10825 2193892..2194362 + 471 Protein_2122 tail fiber assembly protein -
L0F57_RS10830 2194459..2194659 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2183982..2222299 38317


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T231149 NZ_CP090545:2189682-2189785 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT231149 NZ_CP090545:c2189787-2189642 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References