Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2109900..2110045 Replicon chromosome
Accession NZ_CP090541
Organism Salmonella enterica strain 2010112-SE

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2109940..2110043 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2109900..2110045 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L0F62_RS10275 2106326..2107024 - 699 WP_000944282.1 exodeoxyribonuclease X -
L0F62_RS10280 2107048..2107704 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
L0F62_RS10285 2107812..2108042 - 231 WP_000856224.1 DNA polymerase III subunit theta -
L0F62_RS10290 2108180..2108554 + 375 WP_000168393.1 CopC domain-containing protein YobA -
L0F62_RS10295 2108555..2109430 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
L0F62_RS10300 2109447..2109800 + 354 WP_000722368.1 YebY family protein -
- 2109900..2110045 - 146 - - Antitoxin
- 2109940..2110043 + 104 - - Toxin
L0F62_RS10305 2110174..2111097 - 924 Protein_2018 tyrosine-type recombinase/integrase -
L0F62_RS10310 2111361..2111822 - 462 Protein_2019 DNA breaking-rejoining protein -
L0F62_RS10315 2111811..2112002 + 192 Protein_2020 glycoside hydrolase family 19 protein -
L0F62_RS10320 2112056..2112589 + 534 WP_001050882.1 DUF2514 domain-containing protein -
L0F62_RS10325 2112846..2113013 - 168 WP_000789530.1 lytic enzyme -
L0F62_RS10330 2113078..2113266 - 189 WP_001521334.1 hypothetical protein -
L0F62_RS10335 2113321..2113581 + 261 Protein_2024 DUF1441 family protein -
L0F62_RS10340 2113796..2114140 + 345 Protein_2025 macro domain-containing protein -
L0F62_RS10345 2114150..2114620 + 471 Protein_2026 tail fiber assembly protein -
L0F62_RS10350 2114717..2114917 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2104240..2142557 38317


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T231124 NZ_CP090541:2109940-2110043 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT231124 NZ_CP090541:c2110045-2109900 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References