Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2109900..2110045 | Replicon | chromosome |
| Accession | NZ_CP090541 | ||
| Organism | Salmonella enterica strain 2010112-SE | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2109940..2110043 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2109900..2110045 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L0F62_RS10275 | 2106326..2107024 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| L0F62_RS10280 | 2107048..2107704 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L0F62_RS10285 | 2107812..2108042 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L0F62_RS10290 | 2108180..2108554 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L0F62_RS10295 | 2108555..2109430 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L0F62_RS10300 | 2109447..2109800 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2109900..2110045 | - | 146 | - | - | Antitoxin |
| - | 2109940..2110043 | + | 104 | - | - | Toxin |
| L0F62_RS10305 | 2110174..2111097 | - | 924 | Protein_2018 | tyrosine-type recombinase/integrase | - |
| L0F62_RS10310 | 2111361..2111822 | - | 462 | Protein_2019 | DNA breaking-rejoining protein | - |
| L0F62_RS10315 | 2111811..2112002 | + | 192 | Protein_2020 | glycoside hydrolase family 19 protein | - |
| L0F62_RS10320 | 2112056..2112589 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| L0F62_RS10325 | 2112846..2113013 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| L0F62_RS10330 | 2113078..2113266 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| L0F62_RS10335 | 2113321..2113581 | + | 261 | Protein_2024 | DUF1441 family protein | - |
| L0F62_RS10340 | 2113796..2114140 | + | 345 | Protein_2025 | macro domain-containing protein | - |
| L0F62_RS10345 | 2114150..2114620 | + | 471 | Protein_2026 | tail fiber assembly protein | - |
| L0F62_RS10350 | 2114717..2114917 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2104240..2142557 | 38317 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T231124 NZ_CP090541:2109940-2110043 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT231124 NZ_CP090541:c2110045-2109900 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG