Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2193108..2193253 Replicon chromosome
Accession NZ_CP090539
Organism Salmonella enterica strain 2016062-SE

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2193148..2193251 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2193108..2193253 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L0F59_RS10790 2189534..2190232 - 699 WP_000944282.1 exodeoxyribonuclease X -
L0F59_RS10795 2190256..2190912 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
L0F59_RS10800 2191020..2191250 - 231 WP_000856224.1 DNA polymerase III subunit theta -
L0F59_RS10805 2191388..2191762 + 375 WP_000168393.1 CopC domain-containing protein YobA -
L0F59_RS10810 2191763..2192638 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
L0F59_RS10815 2192655..2193008 + 354 WP_000722368.1 YebY family protein -
- 2193108..2193253 - 146 - - Antitoxin
- 2193148..2193251 + 104 - - Toxin
L0F59_RS10820 2193382..2194305 - 924 Protein_2121 tyrosine-type recombinase/integrase -
L0F59_RS10825 2194569..2195030 - 462 Protein_2122 DNA breaking-rejoining protein -
L0F59_RS10830 2195019..2195210 + 192 Protein_2123 glycoside hydrolase family 19 protein -
L0F59_RS10835 2195264..2195797 + 534 WP_001050882.1 DUF2514 domain-containing protein -
L0F59_RS10840 2196054..2196221 - 168 WP_000789530.1 lytic enzyme -
L0F59_RS10845 2196286..2196474 - 189 WP_001521334.1 hypothetical protein -
L0F59_RS10850 2196529..2196789 + 261 Protein_2127 DUF1441 family protein -
L0F59_RS10855 2197004..2197348 + 345 Protein_2128 macro domain-containing protein -
L0F59_RS10860 2197358..2197828 + 471 Protein_2129 tail fiber assembly protein -
L0F59_RS10865 2197925..2198125 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2185771..2225765 39994


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T231099 NZ_CP090539:2193148-2193251 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT231099 NZ_CP090539:c2193253-2193108 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References