Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2193108..2193253 | Replicon | chromosome |
| Accession | NZ_CP090539 | ||
| Organism | Salmonella enterica strain 2016062-SE | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2193148..2193251 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2193108..2193253 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L0F59_RS10790 | 2189534..2190232 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| L0F59_RS10795 | 2190256..2190912 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L0F59_RS10800 | 2191020..2191250 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L0F59_RS10805 | 2191388..2191762 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L0F59_RS10810 | 2191763..2192638 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L0F59_RS10815 | 2192655..2193008 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2193108..2193253 | - | 146 | - | - | Antitoxin |
| - | 2193148..2193251 | + | 104 | - | - | Toxin |
| L0F59_RS10820 | 2193382..2194305 | - | 924 | Protein_2121 | tyrosine-type recombinase/integrase | - |
| L0F59_RS10825 | 2194569..2195030 | - | 462 | Protein_2122 | DNA breaking-rejoining protein | - |
| L0F59_RS10830 | 2195019..2195210 | + | 192 | Protein_2123 | glycoside hydrolase family 19 protein | - |
| L0F59_RS10835 | 2195264..2195797 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| L0F59_RS10840 | 2196054..2196221 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| L0F59_RS10845 | 2196286..2196474 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| L0F59_RS10850 | 2196529..2196789 | + | 261 | Protein_2127 | DUF1441 family protein | - |
| L0F59_RS10855 | 2197004..2197348 | + | 345 | Protein_2128 | macro domain-containing protein | - |
| L0F59_RS10860 | 2197358..2197828 | + | 471 | Protein_2129 | tail fiber assembly protein | - |
| L0F59_RS10865 | 2197925..2198125 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2185771..2225765 | 39994 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T231099 NZ_CP090539:2193148-2193251 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT231099 NZ_CP090539:c2193253-2193108 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
