Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2632156..2632301 | Replicon | chromosome |
| Accession | NZ_CP090533 | ||
| Organism | Salmonella enterica strain 2017005-SE | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2632158..2632261 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2632156..2632301 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L0F61_RS12950 | 2627284..2627484 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| L0F61_RS12955 | 2627581..2628051 | - | 471 | Protein_2529 | tail fiber assembly protein | - |
| L0F61_RS12960 | 2628061..2628405 | - | 345 | Protein_2530 | macro domain-containing protein | - |
| L0F61_RS12965 | 2628620..2628880 | - | 261 | Protein_2531 | DUF1441 family protein | - |
| L0F61_RS12970 | 2628935..2629123 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| L0F61_RS12975 | 2629188..2629355 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| L0F61_RS12980 | 2629612..2630145 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| L0F61_RS12985 | 2630199..2630390 | - | 192 | Protein_2535 | glycoside hydrolase family 19 protein | - |
| L0F61_RS12990 | 2630379..2630840 | + | 462 | Protein_2536 | DNA breaking-rejoining protein | - |
| L0F61_RS12995 | 2631104..2632027 | + | 924 | Protein_2537 | tyrosine-type recombinase/integrase | - |
| - | 2632156..2632301 | + | 146 | - | - | Antitoxin |
| - | 2632158..2632261 | - | 104 | - | - | Toxin |
| L0F61_RS13000 | 2632401..2632754 | - | 354 | WP_000722368.1 | YebY family protein | - |
| L0F61_RS13005 | 2632771..2633646 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L0F61_RS13010 | 2633647..2634021 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L0F61_RS13015 | 2634159..2634389 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L0F61_RS13020 | 2634497..2635153 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L0F61_RS13025 | 2635177..2635875 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2609961..2637961 | 28000 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T231050 NZ_CP090533:c2632261-2632158 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT231050 NZ_CP090533:2632156-2632301 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG