Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2632156..2632301 Replicon chromosome
Accession NZ_CP090533
Organism Salmonella enterica strain 2017005-SE

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2632158..2632261 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2632156..2632301 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L0F61_RS12950 2627284..2627484 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
L0F61_RS12955 2627581..2628051 - 471 Protein_2529 tail fiber assembly protein -
L0F61_RS12960 2628061..2628405 - 345 Protein_2530 macro domain-containing protein -
L0F61_RS12965 2628620..2628880 - 261 Protein_2531 DUF1441 family protein -
L0F61_RS12970 2628935..2629123 + 189 WP_001521334.1 hypothetical protein -
L0F61_RS12975 2629188..2629355 + 168 WP_000789530.1 lytic enzyme -
L0F61_RS12980 2629612..2630145 - 534 WP_001050882.1 DUF2514 domain-containing protein -
L0F61_RS12985 2630199..2630390 - 192 Protein_2535 glycoside hydrolase family 19 protein -
L0F61_RS12990 2630379..2630840 + 462 Protein_2536 DNA breaking-rejoining protein -
L0F61_RS12995 2631104..2632027 + 924 Protein_2537 tyrosine-type recombinase/integrase -
- 2632156..2632301 + 146 - - Antitoxin
- 2632158..2632261 - 104 - - Toxin
L0F61_RS13000 2632401..2632754 - 354 WP_000722368.1 YebY family protein -
L0F61_RS13005 2632771..2633646 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
L0F61_RS13010 2633647..2634021 - 375 WP_000168393.1 CopC domain-containing protein YobA -
L0F61_RS13015 2634159..2634389 + 231 WP_000856224.1 DNA polymerase III subunit theta -
L0F61_RS13020 2634497..2635153 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
L0F61_RS13025 2635177..2635875 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2609961..2637961 28000


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T231050 NZ_CP090533:c2632261-2632158 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT231050 NZ_CP090533:2632156-2632301 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References