Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1968048..1968193 | Replicon | chromosome |
Accession | NZ_CP090304 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain ZJUJY |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1968050..1968153 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1968048..1968193 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LPC12_RS09630 | 1963176..1963376 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
LPC12_RS09635 | 1963473..1963943 | - | 471 | Protein_1884 | tail fiber assembly protein | - |
LPC12_RS09640 | 1963953..1964297 | - | 345 | Protein_1885 | macro domain-containing protein | - |
LPC12_RS09645 | 1964512..1964772 | - | 261 | Protein_1886 | DUF1441 family protein | - |
LPC12_RS09650 | 1964827..1965015 | + | 189 | WP_001521334.1 | hypothetical protein | - |
LPC12_RS09655 | 1965080..1965247 | + | 168 | WP_000789530.1 | lytic enzyme | - |
LPC12_RS09660 | 1965504..1966037 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
LPC12_RS09665 | 1966091..1966282 | - | 192 | Protein_1890 | glycoside hydrolase family 19 protein | - |
LPC12_RS09670 | 1966271..1966732 | + | 462 | Protein_1891 | DNA breaking-rejoining protein | - |
LPC12_RS09675 | 1966996..1967919 | + | 924 | Protein_1892 | tyrosine-type recombinase/integrase | - |
- | 1968048..1968193 | + | 146 | - | - | Antitoxin |
- | 1968050..1968153 | - | 104 | - | - | Toxin |
LPC12_RS09680 | 1968293..1968646 | - | 354 | WP_000722368.1 | YebY family protein | - |
LPC12_RS09685 | 1968663..1969538 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
LPC12_RS09690 | 1969539..1969913 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LPC12_RS09695 | 1970051..1970281 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LPC12_RS09700 | 1970389..1971045 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
LPC12_RS09705 | 1971069..1971767 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 1935544..1973853 | 38309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T230377 NZ_CP090304:c1968153-1968050 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT230377 NZ_CP090304:1968048-1968193 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG