Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2118201..2118346 | Replicon | chromosome |
| Accession | NZ_CP088138 | ||
| Organism | Salmonella enterica subsp. enterica serovar Hissar strain SCPM-O-B-4549 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2118241..2118344 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2118201..2118346 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LRM92_RS10315 | 2114627..2115325 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| LRM92_RS10320 | 2115349..2116005 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| LRM92_RS10325 | 2116113..2116343 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LRM92_RS10330 | 2116481..2116855 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LRM92_RS10335 | 2116856..2117731 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| LRM92_RS10340 | 2117748..2118101 | + | 354 | WP_000722364.1 | YebY family protein | - |
| - | 2118201..2118346 | - | 146 | - | - | Antitoxin |
| - | 2118241..2118344 | + | 104 | - | - | Toxin |
| LRM92_RS10345 | 2118475..2119398 | - | 924 | Protein_2027 | tyrosine-type recombinase/integrase | - |
| LRM92_RS10350 | 2119662..2120123 | - | 462 | Protein_2028 | DNA breaking-rejoining protein | - |
| LRM92_RS10355 | 2120112..2120303 | + | 192 | Protein_2029 | glycoside hydrolase family 19 protein | - |
| LRM92_RS10360 | 2120357..2120890 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| LRM92_RS10365 | 2121147..2121314 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| LRM92_RS10370 | 2121379..2121567 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| LRM92_RS10375 | 2121622..2121882 | + | 261 | Protein_2033 | DUF1441 family protein | - |
| LRM92_RS10380 | 2122097..2122441 | + | 345 | Protein_2034 | macro domain-containing protein | - |
| LRM92_RS10385 | 2122451..2122921 | + | 471 | Protein_2035 | tail fiber assembly protein | - |
| LRM92_RS10390 | 2123018..2123218 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2112541..2150850 | 38309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T226794 NZ_CP088138:2118241-2118344 [Salmonella enterica subsp. enterica serovar Hissar]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT226794 NZ_CP088138:c2118346-2118201 [Salmonella enterica subsp. enterica serovar Hissar]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
