Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2112769..2112914 Replicon chromosome
Accession NZ_CP086118
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain S34

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2112809..2112912 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2112769..2112914 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
LLY43_RS10250 2109195..2109893 - 699 WP_000944282.1 exodeoxyribonuclease X -
LLY43_RS10255 2109917..2110573 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
LLY43_RS10260 2110681..2110911 - 231 WP_000856224.1 DNA polymerase III subunit theta -
LLY43_RS10265 2111049..2111423 + 375 WP_000168393.1 CopC domain-containing protein YobA -
LLY43_RS10270 2111424..2112299 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
LLY43_RS10275 2112316..2112669 + 354 WP_000722368.1 YebY family protein -
- 2112769..2112914 - 146 - - Antitoxin
- 2112809..2112912 + 104 - - Toxin
LLY43_RS10280 2113043..2113966 - 924 Protein_2013 tyrosine-type recombinase/integrase -
LLY43_RS10285 2114230..2114691 - 462 Protein_2014 DNA breaking-rejoining protein -
LLY43_RS10290 2114680..2114871 + 192 Protein_2015 glycoside hydrolase family 19 protein -
LLY43_RS10295 2114925..2115458 + 534 WP_001050882.1 DUF2514 domain-containing protein -
LLY43_RS10300 2115715..2115882 - 168 WP_000789530.1 lytic enzyme -
LLY43_RS10305 2115947..2116135 - 189 WP_001521334.1 hypothetical protein -
LLY43_RS10310 2116190..2116450 + 261 Protein_2019 DUF1441 family protein -
LLY43_RS10315 2116665..2117009 + 345 Protein_2020 macro domain-containing protein -
LLY43_RS10320 2117019..2117489 + 471 Protein_2021 tail fiber assembly protein -
LLY43_RS10325 2117586..2117786 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2107109..2145426 38317


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T222552 NZ_CP086118:2112809-2112912 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT222552 NZ_CP086118:c2112914-2112769 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References