Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 422531..422676 Replicon chromosome
Accession NZ_CP085987
Organism Salmonella enterica strain SZL 38

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 422571..422674 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 422531..422676 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
LKX03_RS02645 418957..419655 - 699 WP_000944282.1 exodeoxyribonuclease X -
LKX03_RS02650 419679..420335 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
LKX03_RS02655 420443..420673 - 231 WP_000856224.1 DNA polymerase III subunit theta -
LKX03_RS02660 420811..421185 + 375 WP_000168393.1 CopC domain-containing protein YobA -
LKX03_RS02665 421186..422061 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
LKX03_RS02670 422078..422431 + 354 WP_000722368.1 YebY family protein -
- 422531..422676 - 146 - - Antitoxin
- 422571..422674 + 104 - - Toxin
LKX03_RS02675 422805..423728 - 924 Protein_443 tyrosine-type recombinase/integrase -
LKX03_RS02680 423992..424453 - 462 Protein_444 DNA breaking-rejoining protein -
LKX03_RS02685 424442..424633 + 192 Protein_445 glycoside hydrolase family 19 protein -
LKX03_RS02690 424687..425220 + 534 WP_001050882.1 DUF2514 domain-containing protein -
LKX03_RS02695 425477..425644 - 168 WP_000789530.1 lytic enzyme -
LKX03_RS02700 425709..425897 - 189 WP_001521334.1 hypothetical protein -
LKX03_RS02705 425952..426212 + 261 Protein_449 DUF1441 family protein -
LKX03_RS02710 426427..426771 + 345 Protein_450 macro domain-containing protein -
LKX03_RS02715 426781..427251 + 471 Protein_451 tail fiber assembly protein -
LKX03_RS02720 427348..427548 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 416871..455188 38317


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T222405 NZ_CP085987:422571-422674 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT222405 NZ_CP085987:c422676-422531 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References