Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 4016865..4017010 | Replicon | chromosome |
| Accession | NZ_CP085819 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain Blastoise | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 4016905..4017008 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 4016865..4017010 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LJF65_RS19275 | 4013291..4013989 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| LJF65_RS19280 | 4014013..4014669 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| LJF65_RS19285 | 4014777..4015007 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LJF65_RS19290 | 4015145..4015519 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LJF65_RS19295 | 4015520..4016395 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| LJF65_RS19300 | 4016412..4016765 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 4016865..4017010 | - | 146 | - | - | Antitoxin |
| - | 4016905..4017008 | + | 104 | - | - | Toxin |
| LJF65_RS19305 | 4017139..4018062 | - | 924 | Protein_3756 | tyrosine-type recombinase/integrase | - |
| LJF65_RS19310 | 4018326..4018787 | - | 462 | Protein_3757 | DNA breaking-rejoining protein | - |
| LJF65_RS19315 | 4018776..4018967 | + | 192 | Protein_3758 | glycoside hydrolase family 19 protein | - |
| LJF65_RS19320 | 4019021..4019554 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| LJF65_RS19325 | 4019811..4019978 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| LJF65_RS19330 | 4020043..4020231 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| LJF65_RS19335 | 4020286..4020546 | + | 261 | Protein_3762 | DUF1441 family protein | - |
| LJF65_RS19340 | 4020761..4021105 | + | 345 | Protein_3763 | macro domain-containing protein | - |
| LJF65_RS19345 | 4021115..4021585 | + | 471 | Protein_3764 | tail fiber assembly protein | - |
| LJF65_RS19350 | 4021682..4021882 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 4011205..4049513 | 38308 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221971 NZ_CP085819:4016905-4017008 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221971 NZ_CP085819:c4017010-4016865 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
