Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2063653..2063798 | Replicon | chromosome |
| Accession | NZ_CP081189 | ||
| Organism | Salmonella enterica strain sg1722-2 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2063693..2063796 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2063653..2063798 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K4F90_RS09950 | 2060079..2060777 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K4F90_RS09955 | 2060801..2061457 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K4F90_RS09960 | 2061565..2061795 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K4F90_RS09965 | 2061933..2062307 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K4F90_RS09970 | 2062308..2063183 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K4F90_RS09975 | 2063200..2063553 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2063653..2063798 | - | 146 | - | - | Antitoxin |
| - | 2063693..2063796 | + | 104 | - | - | Toxin |
| K4F90_RS09980 | 2063927..2064850 | - | 924 | Protein_1955 | tyrosine-type recombinase/integrase | - |
| K4F90_RS09985 | 2065114..2065575 | - | 462 | Protein_1956 | DNA breaking-rejoining protein | - |
| K4F90_RS09990 | 2065564..2065755 | + | 192 | Protein_1957 | glycoside hydrolase family 19 protein | - |
| K4F90_RS09995 | 2065809..2066342 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K4F90_RS10000 | 2066599..2066766 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K4F90_RS10005 | 2066831..2067019 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K4F90_RS10010 | 2067074..2067334 | + | 261 | Protein_1961 | DUF1441 family protein | - |
| K4F90_RS10015 | 2067549..2067893 | + | 345 | Protein_1962 | macro domain-containing protein | - |
| K4F90_RS10020 | 2067903..2068373 | + | 471 | Protein_1963 | tail fiber assembly protein | - |
| K4F90_RS10025 | 2068470..2068670 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2057993..2085993 | 28000 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T212675 NZ_CP081189:2063693-2063796 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT212675 NZ_CP081189:c2063798-2063653 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
