Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2063653..2063798 Replicon chromosome
Accession NZ_CP081189
Organism Salmonella enterica strain sg1722-2

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2063693..2063796 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2063653..2063798 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
K4F90_RS09950 2060079..2060777 - 699 WP_000944282.1 exodeoxyribonuclease X -
K4F90_RS09955 2060801..2061457 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
K4F90_RS09960 2061565..2061795 - 231 WP_000856224.1 DNA polymerase III subunit theta -
K4F90_RS09965 2061933..2062307 + 375 WP_000168393.1 CopC domain-containing protein YobA -
K4F90_RS09970 2062308..2063183 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
K4F90_RS09975 2063200..2063553 + 354 WP_000722368.1 YebY family protein -
- 2063653..2063798 - 146 - - Antitoxin
- 2063693..2063796 + 104 - - Toxin
K4F90_RS09980 2063927..2064850 - 924 Protein_1955 tyrosine-type recombinase/integrase -
K4F90_RS09985 2065114..2065575 - 462 Protein_1956 DNA breaking-rejoining protein -
K4F90_RS09990 2065564..2065755 + 192 Protein_1957 glycoside hydrolase family 19 protein -
K4F90_RS09995 2065809..2066342 + 534 WP_001050882.1 DUF2514 domain-containing protein -
K4F90_RS10000 2066599..2066766 - 168 WP_000789530.1 lytic enzyme -
K4F90_RS10005 2066831..2067019 - 189 WP_001521334.1 hypothetical protein -
K4F90_RS10010 2067074..2067334 + 261 Protein_1961 DUF1441 family protein -
K4F90_RS10015 2067549..2067893 + 345 Protein_1962 macro domain-containing protein -
K4F90_RS10020 2067903..2068373 + 471 Protein_1963 tail fiber assembly protein -
K4F90_RS10025 2068470..2068670 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2057993..2085993 28000


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T212675 NZ_CP081189:2063693-2063796 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT212675 NZ_CP081189:c2063798-2063653 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References