Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1991675..1991818 | Replicon | chromosome |
| Accession | NZ_CP075116 | ||
| Organism | Salmonella enterica subsp. enterica serovar Stanleyville strain CFSAN059881 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1991713..1991816 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1991675..1991818 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CCO40_RS09490 | 1988099..1988797 | - | 699 | WP_000944287.1 | exodeoxyribonuclease X | - |
| CCO40_RS09495 | 1988821..1989477 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| CCO40_RS09500 | 1989585..1989815 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| CCO40_RS09505 | 1989953..1990327 | + | 375 | WP_094889159.1 | CopC domain-containing protein YobA | - |
| CCO40_RS09510 | 1990328..1991203 | + | 876 | WP_094889158.1 | copper homeostasis membrane protein CopD | - |
| CCO40_RS09515 | 1991220..1991573 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1991675..1991818 | - | 144 | - | - | Antitoxin |
| - | 1991713..1991816 | + | 104 | - | - | Toxin |
| CCO40_RS09520 | 1991947..1992870 | - | 924 | Protein_1864 | tyrosine-type recombinase/integrase | - |
| CCO40_RS22455 | 1993134..1993595 | - | 462 | Protein_1865 | DNA breaking-rejoining protein | - |
| CCO40_RS09530 | 1993584..1993775 | + | 192 | Protein_1866 | glycoside hydrolase family 19 protein | - |
| CCO40_RS09535 | 1993829..1994362 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| CCO40_RS09540 | 1994619..1994786 | - | 168 | WP_000789529.1 | lytic enzyme | - |
| CCO40_RS09545 | 1995094..1995354 | + | 261 | Protein_1869 | DUF1441 family protein | - |
| CCO40_RS09550 | 1995356..1995616 | + | 261 | Protein_1870 | hypothetical protein | - |
| CCO40_RS22460 | 1995769..1996056 | + | 288 | Protein_1871 | macro domain-containing protein | - |
| CCO40_RS09560 | 1996069..1996580 | + | 512 | Protein_1872 | tail fiber assembly protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1986011..2024534 | 38523 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202976 NZ_CP075116:1991713-1991816 [Salmonella enterica subsp. enterica serovar Stanleyville]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT202976 NZ_CP075116:c1991818-1991675 [Salmonella enterica subsp. enterica serovar Stanleyville]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
