Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1991675..1991818 Replicon chromosome
Accession NZ_CP075116
Organism Salmonella enterica subsp. enterica serovar Stanleyville strain CFSAN059881

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1991713..1991816 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1991675..1991818 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
CCO40_RS09490 1988099..1988797 - 699 WP_000944287.1 exodeoxyribonuclease X -
CCO40_RS09495 1988821..1989477 - 657 WP_000100249.1 carbon-nitrogen hydrolase family protein -
CCO40_RS09500 1989585..1989815 - 231 WP_000856224.1 DNA polymerase III subunit theta -
CCO40_RS09505 1989953..1990327 + 375 WP_094889159.1 CopC domain-containing protein YobA -
CCO40_RS09510 1990328..1991203 + 876 WP_094889158.1 copper homeostasis membrane protein CopD -
CCO40_RS09515 1991220..1991573 + 354 WP_000722368.1 YebY family protein -
- 1991675..1991818 - 144 - - Antitoxin
- 1991713..1991816 + 104 - - Toxin
CCO40_RS09520 1991947..1992870 - 924 Protein_1864 tyrosine-type recombinase/integrase -
CCO40_RS22455 1993134..1993595 - 462 Protein_1865 DNA breaking-rejoining protein -
CCO40_RS09530 1993584..1993775 + 192 Protein_1866 glycoside hydrolase family 19 protein -
CCO40_RS09535 1993829..1994362 + 534 WP_001050883.1 DUF2514 domain-containing protein -
CCO40_RS09540 1994619..1994786 - 168 WP_000789529.1 lytic enzyme -
CCO40_RS09545 1995094..1995354 + 261 Protein_1869 DUF1441 family protein -
CCO40_RS09550 1995356..1995616 + 261 Protein_1870 hypothetical protein -
CCO40_RS22460 1995769..1996056 + 288 Protein_1871 macro domain-containing protein -
CCO40_RS09560 1996069..1996580 + 512 Protein_1872 tail fiber assembly protein -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1986011..2024534 38523


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T202976 NZ_CP075116:1991713-1991816 [Salmonella enterica subsp. enterica serovar Stanleyville]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT202976 NZ_CP075116:c1991818-1991675 [Salmonella enterica subsp. enterica serovar Stanleyville]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References