Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1968048..1968193 Replicon chromosome
Accession NZ_CP074092
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SO_8752_Stm

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1968050..1968153 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1968048..1968193 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
KFK83_RS09590 1963176..1963376 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
KFK83_RS09595 1963473..1963943 - 471 Protein_1883 tail fiber assembly protein -
KFK83_RS09600 1963953..1964297 - 345 Protein_1884 macro domain-containing protein -
KFK83_RS09605 1964512..1964772 - 261 Protein_1885 DUF1441 family protein -
KFK83_RS09610 1964827..1965015 + 189 WP_001521334.1 hypothetical protein -
KFK83_RS09615 1965080..1965247 + 168 WP_000789530.1 lytic enzyme -
KFK83_RS09620 1965504..1966037 - 534 WP_001050882.1 DUF2514 domain-containing protein -
KFK83_RS09625 1966091..1966282 - 192 Protein_1889 glycoside hydrolase family 19 protein -
KFK83_RS24100 1966271..1966732 + 462 Protein_1890 DNA breaking-rejoining protein -
KFK83_RS09635 1966996..1967919 + 924 Protein_1891 tyrosine-type recombinase/integrase -
- 1968048..1968193 + 146 - - Antitoxin
- 1968050..1968153 - 104 - - Toxin
KFK83_RS09640 1968293..1968646 - 354 WP_000722368.1 YebY family protein -
KFK83_RS09645 1968663..1969538 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
KFK83_RS09650 1969539..1969913 - 375 WP_000168393.1 CopC domain-containing protein YobA -
KFK83_RS09655 1970051..1970281 + 231 WP_000856224.1 DNA polymerase III subunit theta -
KFK83_RS09660 1970389..1971045 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
KFK83_RS09665 1971069..1971767 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1935544..1973853 38309


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T201368 NZ_CP074092:c1968153-1968050 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT201368 NZ_CP074092:1968048-1968193 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References